Effects of ethyl acetate extract of Salsola collina on brain-gut peptides and interstitial cells

Comparability of two business ELISA kits for detection of rubella particular IgM in suspected congenital rubella syndrome circumstances and rubella IgG antibodies in a serosurvey of pregnant girls.

Enzyme linked immunosorbent assay (ELISA) for antibody identification, is necessary for laboratory affirmation of rubella an infection in numerous settings. The Enzygnost rubella ELISA, broadly used within the World Well being Group (WHO) World Measles and Rubella Laboratory Community, is dear and infrequently unavailable.

Qualitative and quantitative efficiency of the Euroimmun ELISA was in contrast with the Enzygnost ELISA, for detection of rubella particular IgM, utilizing 283 sera collected from suspected congenital rubella syndrome (CRS) sufferers and IgG antibodies utilizing 435 sera from a serosurvey amongst pregnant girls.

Good qualitative settlement was noticed for detection of each rubella particular IgM (94.7% settlement and κ of 0.86) and IgG (96.3% settlement and κ of 0.84). Bland-Altman evaluation for IgG yielded a imply distinction of 0.781 IU/ml with 97.1% values inside ±2 SD of the imply distinction.

Our examine findings recommend that Euroimmun ELISA could also be thought-about for detection of rubella particular IgM in suspected CRS circumstances and rubella particular IgG in surveillance research.

 

Human Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-Hu-96T	DL Develop	96T	EUR 621
Should the Human Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-p-48T	DL Develop	48T	EUR 547
Should the Porcine Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-p-96T	DL Develop	96T	EUR 715
Should the Porcine Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Porcine Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Diamine Oxidase (DAO) ELISA Kit
RDR-DAO-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Diamine Oxidase (DAO) ELISA Kit
RD-DAO-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Diamine Oxidase (DAO) ELISA Kit
RD-DAO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Porcine Diamine Oxidase (DAO) ELISA Kit
RD-DAO-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Diamine Oxidase (DAO) ELISA Kit
RD-DAO-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Diamine Oxidase (DAO) ELISA Kit
RD-DAO-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Diamine Oxidase (DAO) ELISA Kit
RD-DAO-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Dao/ Rat Dao ELISA Kit
ELI-46592r	Lifescience Market	96 Tests	EUR 886

Mouse DAO ELISA Kit
EMD0039	Abclonal	96Tests	EUR 521

Mouse diamine oxidase(DAO)ELISA Kit
GA-E0588MS-48T	GenAsia Biotech	48T	EUR 336

Mouse diamine oxidase(DAO)ELISA Kit
GA-E0588MS-96T	GenAsia Biotech	96T	EUR 534

Mouse DAO(Diamine Oxidase) ELISA Kit
EM0980	FN Test	96T	EUR 524.1
Detection range: 3.906-250 ng/ml Uniprot ID: P18894 Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml

Mouse diamine oxidase, DAO ELISA Kit
CSB-E10090m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse diamine oxidase, DAO ELISA Kit
1-CSB-E10090m	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse diamine oxidase,DAO ELISA Kit
CN-02511M1	ChemNorm	96T	EUR 436

Mouse diamine oxidase,DAO ELISA Kit
CN-02511M2	ChemNorm	48T	EUR 287

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
4-SEA656Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1 ABP1 KAO Histaminase Kidney amine oxidase Amiloride Binding Protein 1 Amiloride-sensitive amine oxidase Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Diamine Oxidase ELISA Kit (DAO)
RK02737	Abclonal	96 Tests	EUR 521

Mouse diamine oxidase(DAO)ELISA Kit
QY-E20470	Qayee Biotechnology	96T	EUR 361

Human DAO ELISA Kit
EHD0039	Abclonal	96Tests	EUR 521

Human DAO ELISA Kit
ELA-E13922h	Lifescience Market	96 Tests	EUR 824

Goat DAO ELISA Kit
EGTD0039	Abclonal	96Tests	EUR 521

Canine DAO ELISA Kit
ECD0039	Abclonal	96Tests	EUR 521

Chicken DAO ELISA Kit
ECKD0039	Abclonal	96Tests	EUR 521

Bovine DAO ELISA Kit
EBD0039	Abclonal	96Tests	EUR 521

Anserini DAO ELISA Kit
EAD0039	Abclonal	96Tests	EUR 521

DAO ELISA KIT|Human
EF005669	Lifescience Market	96 Tests	EUR 689

Porcine DAO ELISA Kit
EPD0039	Abclonal	96Tests	EUR 521

Rat DAO ELISA Kit
ERD0039	Abclonal	96Tests	EUR 521

Rabbit DAO ELISA Kit
ERTD0039	Abclonal	96Tests	EUR 521

Sheep DAO ELISA Kit
ESD0039	Abclonal	96Tests	EUR 521

Monkey DAO ELISA Kit
EMKD0039	Abclonal	96Tests	EUR 521

DAO ELISA Kit| Mouse Diamine Oxidase ELISA Kit
EF013561	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ELISA kit for Mouse DAO (Diamine Oxidase)
E-EL-M0412	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse DAO (Diamine Oxidase)
ELK5316	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)
KTE70533-48T	Abbkine	48T	EUR 354
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)
KTE70533-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)
KTE70533-96T	Abbkine	96T	EUR 572
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea Pig DAO ELISA Kit
EGD0039	Abclonal	96Tests	EUR 521

Mouse Dao/ D-amino-acid oxidase ELISA Kit
E0378Mo	Sunlong	1 Kit	EUR 632

Mouse D- amino- acid oxidase, Dao ELISA KIT
ELI-16169m	Lifescience Market	96 Tests	EUR 865

Dao ELISA Kit| Mouse D-amino-acid oxidase ELISA Kit
EF014627	Lifescience Market	96 Tests	EUR 689

Mouse Diamine Oxidase (DAO) CLIA Kit
abx195143-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) CLIA Kit
20-abx491836	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse DAO shRNA Plasmid
20-abx969943	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DAO Recombinant Protein (Mouse)
RP127823	ABM	100 ug	Ask for price

Porcine diamine oxidase, DAO ELISA Kit
ELA-E0656p	Lifescience Market	96 Tests	EUR 928

Rat diamine oxidase, DAO ELISA Kit
ELA-E0656r	Lifescience Market	96 Tests	EUR 886

Bovine DAO(Diamine Oxidase) ELISA Kit
EB0118	FN Test	96T	EUR 567.6
Detection range: 15.625-1000 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 9.375 ng/ml

Rat diamine oxidase(DAO)ELISA Kit
GA-E0233RT-48T	GenAsia Biotech	48T	EUR 317

Rat diamine oxidase(DAO)ELISA Kit
GA-E0233RT-96T	GenAsia Biotech	96T	EUR 496

Human diamine oxidase(DAO)ELISA Kit
GA-E0793HM-48T	GenAsia Biotech	48T	EUR 289

Human diamine oxidase(DAO)ELISA Kit
GA-E0793HM-96T	GenAsia Biotech	96T	EUR 466

Rat DAO(Diamine Oxidase) ELISA Kit
ER0895	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: O35078 Alias: DAO
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 1.875 ng/ml

Porcine DAO(Diamine Oxidase) ELISA Kit
EP0047	FN Test	96T	EUR 567.6
Detection range: 1.563-100 ng/ml Alias: Amiloride-binding protein 1/Amine oxidase copper domain-containing protein 1/Histaminase/Kidney amine oxidase/KAO/ABP1/DAO1/AOC1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 0.938 ng/ml

Human diamine oxidase,DAO ELISA Kit
201-12-0777	SunredBio	96 tests	EUR 440
This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human diamine oxidase, DAO ELISA Kit
CSB-E10137h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human diamine oxidase, DAO ELISA Kit
1-CSB-E10137h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat diamine oxidase(DAO) ELISA Kit
CSB-E12634r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase (DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat diamine oxidase(DAO) ELISA Kit
1-CSB-E12634r	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase(DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PoFAine diamine oxidase,DAO ELISA Kit
CN-01272P1	ChemNorm	96T	EUR 447

PoFAine diamine oxidase,DAO ELISA Kit
CN-01272P2	ChemNorm	48T	EUR 296

Human diamine oxidase,DAO ELISA Kit
CN-03719H1	ChemNorm	96T	EUR 458

Human diamine oxidase,DAO ELISA Kit
CN-03719H2	ChemNorm	48T	EUR 307

Human Diamine Oxidase (DAO) ELISA Kit
SEA656Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
SEA656Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
SEA656Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
SEA656Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
4-SEA656Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1 ABP1 KAO Histaminase Kidney amine oxidase Amiloride Binding Protein 1 Amiloride-sensitive amine oxidase Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pig Diamine Oxidase (DAO) ELISA Kit
SEA656Po-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5098.02
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit
SEA656Po-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 507.48
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit
SEA656Po-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 682.12
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit
SEA656Po-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2769.54
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit
4-SEA656Po	Cloud-Clone	EUR 5149.00 EUR 2720.00 EUR 683.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1 ABP1 KAO Histaminase Kidney amine oxidase Amiloride Binding Protein 1 Amiloride-sensitive amine oxidase Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Pig Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Diamine Oxidase (DAO) ELISA Kit
SEA656Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
SEA656Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
SEA656Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
SEA656Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit
4-SEA656Ra	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1 ABP1 KAO Histaminase Kidney amine oxidase Amiloride Binding Protein 1 Amiloride-sensitive amine oxidase Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Diamine Oxidase ELISA Kit (DAO)
RK01242	Abclonal	96 Tests	EUR 521

Porcine Diamine Oxidase ELISA Kit (DAO)
RK03313	Abclonal	96 Tests	EUR 521

Rat Diamine Oxidase ELISA Kit (DAO)
RK03613	Abclonal	96 Tests	EUR 521

Human diamine oxidase(DAO)ELISA Kit
QY-E03708	Qayee Biotechnology	96T	EUR 361

Rat diamine oxidase(DAO)ELISA Kit
QY-E11419	Qayee Biotechnology	96T	EUR 361

Goat diamine oxidase,DAO ELISA KIT
QY-E140016	Qayee Biotechnology	96T	EUR 413

Porcine diamine oxidase (DAO) ELISA Kit
QY-E40051	Qayee Biotechnology	96T	EUR 400

Canine diamine oxidase,DAO ELISA Kit
QY-E70001	Qayee Biotechnology	96T	EUR 426

DAO ELISA Kit| Porcine Diamine Oxidase ELISA Kit
EF016588	Lifescience Market	96 Tests	EUR 689

DAO ELISA Kit| Rat Diamine Oxidase ELISA Kit
EF017679	Lifescience Market	96 Tests	EUR 689

DAO siRNA
20-abx901408	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAO siRNA
20-abx913556	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAO siRNA
20-abx913557	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAO Antibody
ABD7266	Lifescience Market	100 ug	EUR 438

DAO Antibody
32763-100ul	SAB	100ul	EUR 252

DAO Antibody
DF7266	Affbiotech	200ul	EUR 304
Description: DAO Antibody detects endogenous levels of total DAO.

DAO Antibody
1-CSB-PA006494LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAO. Recognizes DAO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:500

Mouse D-Amino Acid Oxidase/ DAMOX (DAO) ELISA Kit
abx516676-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

CLIA kit for Mouse DAO (Diamine Oxidase)
E-CL-M0259	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's DAO CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO . Standards or samples are added to the micro CLIA plate wells and combined with the sp Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Human DAO (Diamine Oxidase)
ELK4306	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to D-Amino Acid Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D-Amino Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig DAO (Diamine Oxidase)
ELK5633	ELK Biotech	1 plate of 96 wells	EUR 526
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Pig in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DAO (Diamine Oxidase)
ELK1773	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat DAO (Diamine Oxidase)
ELK2230	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat DAO (Diamine Oxidase)
E-EL-R0331	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat DAO. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DAO (Diamine Oxidase)
E-EL-H1241	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DAO. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Pig Diamine oxidase (DAO)
KTE80174-48T	Abbkine	48T	EUR 354
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)
KTE80174-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)
KTE80174-96T	Abbkine	96T	EUR 572
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)
KTE100901-48T	Abbkine	48T	EUR 354
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)
KTE100901-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)
KTE100901-96T	Abbkine	96T	EUR 572
On the basis of its primary structure, the amiloride-binding protein (EC 1.4.3.6) is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Diamine Oxidase (DAO) Protein
20-abx066322	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) Protein
20-abx066327	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Dao ORF Vector (Mouse) (pORF)
ORF042609	ABM	1.0 ug DNA	EUR 506

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

DAO Conjugated Antibody
C32763	SAB	100ul	EUR 397

DAO cloning plasmid
CSB-CL006494HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1044 Sequence: atgcgtgtggtggtgattggagcaggagtcatcgggctgtccaccgccctctgcatccatgagcgctaccactcagtcctgcagccactggacataaaggtctacgcggaccgcttcaccccactcaccaccaccgacgtggctgccggcctctggcagccctacctttctgacc Show more
Description: A cloning plasmid for the DAO gene.

anti- DAO antibody
FNab02235	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: D-amino-acid oxidase Uniprot ID: P14920 Gene ID: 1610 Research Area: Metabolism
Description: Antibody raised against DAO

DAO Rabbit pAb
A5309-100ul	Abclonal	100 ul	EUR 308

DAO Rabbit pAb
A5309-200ul	Abclonal	200 ul	EUR 459

DAO Rabbit pAb
A5309-20ul	Abclonal	20 ul	EUR 183

DAO Rabbit pAb
A5309-50ul	Abclonal	50 ul	EUR 223

DAO Polyclonal Antibody
A50181	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DAO Blocking Peptide
DF7266-BP	Affbiotech	1mg	EUR 195

Anti-DAO antibody
PAab02235	Lifescience Market	100 ug	EUR 355

Anti-DAO antibody
STJ27262	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.

Dao ELISA Kit| Rat D-amino-acid oxidase ELISA Kit
EF018550	Lifescience Market	96 Tests	EUR 689

Human DAO/ D-amino-acid oxidase ELISA Kit
E0656Hu	Sunlong	1 Kit	EUR 605

Human DAO(D-amino-acid oxidase) ELISA Kit
EH1546	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: P14920 Alias: DAO(D-amino-acid oxidase)/DAAO/DAMOX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Rabbit D- amino- acid oxidase, DAO ELISA KIT
ELI-23339Ra	Lifescience Market	96 Tests	EUR 928

Human D- amino- acid oxidase, DAO ELISA KIT
ELI-35545h	Lifescience Market	96 Tests	EUR 824

Porcine D- amino- acid oxidase, DAO ELISA KIT
ELI-46591p	Lifescience Market	96 Tests	EUR 928

Human D-Amino Acid Oxidase (DAO) ELISA Kit
DLR-DAMOX-Hu-48T	DL Develop	48T	EUR 517
Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit
DLR-DAMOX-Hu-96T	DL Develop	96T	EUR 673
Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human D-Amino Acid Oxidase ELISA Kit (DAO)
RK01243	Abclonal	96 Tests	EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit
RDR-DAMOX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human D-Amino Acid Oxidase (DAO) ELISA Kit
RDR-DAMOX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human D-Amino Acid Oxidase (DAO) ELISA Kit
RD-DAMOX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit
RD-DAMOX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human D-Amino Acid Oxidase (DAO) ELISA Kit
SEJ298Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit
SEJ298Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit
SEJ298Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit
SEJ298Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit
4-SEJ298Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as D-Amino Acid Oxidase elisa. Alternative names of the recognized antigen: DAMOX
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human D-Amino Acid Oxidase (DAO) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Dao sgRNA CRISPR Lentivector set (Mouse)
K3771901	ABM	3 x 1.0 ug	EUR 339

Diamine Oxidase (DAO) Polyclonal Antibody (Mouse)
4-PAA656Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAO (His292~Asn460) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diamine Oxidase (DAO)

Diamine Oxidase (DAO) Polyclonal Antibody (Mouse)
4-PAA656Mu02	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAO (Arg197~Trp322) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diamine Oxidase (DAO)

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Human Diamine Oxidase (DAO) CLIA Kit
abx195142-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Diamine Oxidase (DAO) CLIA Kit
abx195144-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Diamine Oxidase (DAO) CLIA Kit
20-abx491835	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Pig Diamine Oxidase (DAO) CLIA Kit
20-abx491837	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Diamine Oxidase (DAO) CLIA Kit
20-abx491838	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

 

Zika virus seroprevalence in girls who gave start throughout Zika virus outbreak in Brazil – a potential observational examine

 

Background: The current Zika virus (ZIKV) outbreak in Brazil began in August 2015 and resulted in Might 2017 with out efficient public well being measures for its management have been taken. The immunological standing of a group could not solely predict future outbreaks as properly to reply questions concerning ZIKV not identified but.

 

Goal: To confirm the seroprevalence of ZIKV in a bunch of ladies who had been pregnant in the course of the Zika virus outbreak in Recife, three to 9 months after the supply, and to guage the neurodevelopment of their youngsters.

 

Strategies: A cross-sectional examine enrolled individuals of a cohort examine held at Instituto de Medicina Integral Professor Fernando Figueira (IMIP) in the course of the ZIKV outbreak in Recife. Moms who gave start between the final trimester of 2015 and the primary semester of 2016, interval of the height of microcephaly outbreak in Recife, had been invited. All individuals had the serum examined by the anti-ZIKV IgG/IgM enzyme-liked immunosorbent assays, ELISA equipment (Euroimmun, Lübeck, Germany). All youngsters whose moms offered constructive serology for ZIKV carried out the IgG/IgM ELISA take a look at for ZIKV. These youngsters had been additionally evaluated by a neuropediatrician and the Denver II improvement screening take a look at was utilized.

 

Outcomes: Among the many 132 studied pregnant girls who gave start on the peak of ZIKV outbreak in Recife, all had been ZIKV IgM destructive and 81 (61,3%) had ZIKV IgG constructive. Moms ZIKV IgG constructive had extra fever and rash in the course of the being pregnant as in contrast with moms destructive for ZIKV; respectively 27/81 (33,3%) vs 6/51 (11,7%), p = 0.005 and 22/81 (27,2%) vs 4 (7,8%), p = 0.016. Just one baby had IgG constructive serology for ZIKV. No youngsters had neurodevelopment defect for the age group and the Denver II regular scores.

 

Conclusions: A excessive ZIKV IgG seroprevalence in pregnant girls on the finish of the ZIKV outbreak in Recife was discovered. This discovering means that group protecting immunity could have contributed to the tip of ZIKV outbreak in Recife, Brazil.

Results of ethyl acetate extract of Salsola collina on brain-gut peptides and interstitial cells of gastric Cajal in rats with diabetic gastroparesis

 

Goals: Results of ethyl acetate extract of Salsola collina (EES) on brain-gut peptides and interstitial cells of gastric Cajal in rats with diabetic gastroparesis had been explored.

 

Supplies and strategies: Rats had been divided into six teams: regular management group (NC), diabetic gastroparesis mannequin group (DGP), low, medium, and excessive dose of EES teams (LES, MES, and HES, respectively), and metoclopramide constructive group (MPG). DGP rats had been induced by streptozotocin (STZ) mixed with a high-sugar-high-fat eating regimen.

 

The gastric emptying was measured by the phenol purple labeling methodology. Enzyme-linked immunosorbent assay (ELISA) was employed to find out the concentrations of serum ghrelin, gastrin (GAS), somatostatin (SS), and vasoactive intestinal peptide (VIP). The expressions of c-Package and its pure ligand stem cell issue (SCF) in gastric tissues had been decided by Western blot and immunofluorescence.

 

Outcomes: Gastric emptying fee elevated in a special diploma after intervention by EES, amongst which MES and HES teams confirmed a big impact (in contrast with DGP, P<0.01) and the HES group was equal to the MPG group; serum ghrelin and content material of serum GAS elevated whereas SS and VIP decreased (in contrast with the DGP group, P<0.05 or P<0.01); c-Package and SCF protein expressions in gastric tissue elevated (in contrast with DGP group, P<0.05 or P<0.01).

Conclusion: EES considerably improved gastric emptying by regulating gastrointestinal hormone excretion and c-Package/SCF signaling pathway. Our examine gives a pharmacological foundation for using the EES within the remedy of DGP. Nonetheless, the detailed molecular mechanism stays to be clarified.

Human Adropin (AD) ELISA Kit
RD-AD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Adropin (AD) ELISA Kit
RDR-AD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Adropin (AD) ELISA Kit
RDR-AD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human adropin(AD) ELISA kit
E01A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adropin(AD) ELISA kit
E01A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adropin(AD) ELISA kit
E01A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin ELISA Kit (AD)
RK00809	Abclonal	96 Tests	EUR 521

Human Adropin(AD)ELISA Kit
QY-E05167	Qayee Biotechnology	96T	EUR 400

Human Adropin (AD) ELISA Kit
SEN251Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit
SEN251Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit
SEN251Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit
SEN251Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit
4-SEN251Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO UNQ470 Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Goat adropin(AD) ELISA kit
E06A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adropin(AD) ELISA kit
E06A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adropin(AD) ELISA kit
E06A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit
E02A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit
E02A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit
E02A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit
E03A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit
E03A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit
E03A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit
E04A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit
E04A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit
E04A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit
E08A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit
E08A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit
E08A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit
E07A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit
E07A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit
E07A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit
E09A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit
E09A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit
E09A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AD(Adropin) ELISA Kit
ER1459	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: AD/ENHO/Energy homeostasis-associated protein/Adropin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Adropin ELISA Kit (AD)
RK02568	Abclonal	96 Tests	EUR 521

Mouse Adropin (AD) ELISA Kit
SEN251Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit
SEN251Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit
SEN251Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit
SEN251Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit
4-SEN251Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO UNQ470 Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Adropin (AD) Antibody
20-abx171122	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Adropin (AD) Antibody
20-abx175288	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Recombinant Adropin (AD)
4-RPN251Hu01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6UWT2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 8.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Adropin expressed in: E.coli

Recombinant Adropin (AD)
4-RPN251Mu01	Cloud-Clone	EUR 565.92 EUR 254.00 EUR 1847.20 EUR 682.40 EUR 1264.80 EUR 442.00 EUR 4468.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 8.2kDa Isoelectric Point: 5.4
Description: Recombinant Mouse Adropin expressed in: E.coli

ELISA kit for Human AD (Adropin)
E-EL-H5307	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AD. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AD (Adropin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human AD (Adropin)
ELK6444	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adropin (AD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adropin (AD). Next, A Show more
Description: A sandwich ELISA kit for detection of Adropin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adropin (AD)
KTE60907-48T	Abbkine	48T	EUR 354
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adropin (AD)
KTE60907-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adropin (AD)
KTE60907-96T	Abbkine	96T	EUR 572
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea pig adropin(AD) ELISA kit
E05A1239-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig adropin(AD) ELISA kit
E05A1239-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig adropin(AD) ELISA kit
E05A1239-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse AD (Adropin)
ELK8097	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adropin (AD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adropin (AD). Next, A Show more
Description: A sandwich ELISA kit for detection of Adropin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Adropin (AD)
KTE101165-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Adropin (AD)
KTE101165-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Adropin (AD)
KTE101165-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit
HEN251Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 752.19
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit
HEN251Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3084.86
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit
4-HEN251Hu	Cloud-Clone	EUR 5744.00 EUR 3035.00 EUR 753.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO UNQ470 Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

High Sensitive Human Adropin (AD) ELISA Kit
HEN251Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5693.62
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit
HEN251Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 556.53
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

AD ELISA Kit| Rat Adropin ELISA Kit
EF018137	Lifescience Market	96 Tests	EUR 689

Adropin (AD) Polyclonal Antibody (Human)
4-PAN251Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD)

ELISA kit for Rat AD (Adropin)  Kit
E-EL-R2566	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AD. Standards or samples are added to the micro ELISA plate wells and combined with the spec Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat AD (Adropin)  Kit in samples from Serum, Plasma, Cell supernatant

Adropin (AD) Polyclonal Antibody (Human), APC
4-PAN251Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with APC.

Adropin (AD) Polyclonal Antibody (Human), Biotinylated
4-PAN251Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with Biotin.

Adropin (AD) Polyclonal Antibody (Human), Cy3
4-PAN251Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with Cy3.

Adropin (AD) Polyclonal Antibody (Human), FITC
4-PAN251Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with FITC.

Adropin (AD) Polyclonal Antibody (Human), HRP
4-PAN251Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with HRP.

Adropin (AD) Polyclonal Antibody (Human), PE
4-PAN251Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with PE.

Adropin (AD) Polyclonal Antibody (Human), APC-Cy7
4-PAN251Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Cys34~Pro76 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with APC-Cy7.

Human amiodarone(AD)ELISA Kit
GA-E1909HM-48T	GenAsia Biotech	48T	EUR 289

Human amiodarone(AD)ELISA Kit
GA-E1909HM-96T	GenAsia Biotech	96T	EUR 466

Human amiodarone,AD ELISA Kit
201-12-1893	SunredBio	96 tests	EUR 440
This amiodarone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human amiodarone,AD ELISA Kit
CN-04509H1	ChemNorm	96T	EUR 438

Human amiodarone,AD ELISA Kit
CN-04509H2	ChemNorm	48T	EUR 289

Human amiodarone(AD)ELISA Kit
QY-E00477	Qayee Biotechnology	96T	EUR 361

Human Adropin(ENHO) ELISA kit
E01A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin(ENHO) ELISA kit
E01A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin(ENHO) ELISA kit
E01A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Adropin
EK4627	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adropin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ENHO/ Adropin ELISA Kit
E0790Hu	Sunlong	1 Kit	EUR 571

Human ENHO(Adropin) ELISA Kit
EH2290	FN Test	96T	EUR 567.6
Detection range: 15.625-1000 pg/ml Uniprot ID: Q6UWT2 Alias: ENHO/Energy homeostasis-associated protein/Adropin
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Adropin, ENHO ELISA KIT
ELI-26910h	Lifescience Market	96 Tests	EUR 824

Human Adropin(ENHO) ELISA kit
CSB-EL007669HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adropin (ENHO) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Adropin(ENHO) ELISA kit
1-CSB-EL007669HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adropin(ENHO) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse adropin ELISA Kit
EM1805	FN Test	96T	EUR 567.6
Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

ELISA kit for Human Amiodarone (AD)
KTE62672-48T	Abbkine	48T	EUR 354
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Amiodarone (AD)
KTE62672-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Amiodarone (AD)
KTE62672-96T	Abbkine	96T	EUR 572
Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Enho/ Adropin ELISA Kit
E0464Mo	Sunlong	1 Kit	EUR 571

Goat Adropin(ENHO) ELISA kit
E06A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adropin(ENHO) ELISA kit
E06A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adropin(ENHO) ELISA kit
E06A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit
E03A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit
E03A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit
E03A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit
E04A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit
E04A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit
E04A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit
E02A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit
E02A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit
E02A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit
E07A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit
E07A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit
E07A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit
E09A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit
E09A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit
E09A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit
E08A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit
E08A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit
E08A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Adropin, ENHO ELISA KIT
ELI-27671b	Lifescience Market	96 Tests	EUR 928

Mouse Adropin, Enho ELISA KIT
ELI-32795m	Lifescience Market	96 Tests	EUR 865

Mouse Adropin(ENHO) ELISA kit
CSB-EL007669MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Adropin (ENHO) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Adropin(ENHO) ELISA kit
1-CSB-EL007669MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Adropin(ENHO) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant human Adropin
P1700	FN Test	100ug	Ask for price
Uniprot ID: Q6UWT2 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Adropin

Enho ELISA Kit| Mouse Adropin ELISA Kit
EF014792	Lifescience Market	96 Tests	EUR 689

ENHO ELISA Kit| Bovine Adropin ELISA Kit
EF011352	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

AD 0261
HY-U00005	MedChemExpress	10mg	EUR 3700

pGADT7- AD
PVT4018	Lifescience Market	2 ug	EUR 266

Guinea pig Adropin(ENHO) ELISA kit
E05A1849-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adropin(ENHO) ELISA kit
E05A1849-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adropin(ENHO) ELISA kit
E05A1849-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse AD Protein
20-abx650992	Abbexa	EUR 787.00 EUR 300.00 EUR 2486.00 EUR 940.00 EUR 551.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Valrubicin (AD-32)
B1833-25	Biovision		EUR 746

Valrubicin (AD-32)
B1833-5	Biovision		EUR 224

HBsAg ad Protein
abx060555-100ug	Abbexa	100 ug	EUR 878
Shipped within 5-10 working days.

Polyclonal ADROPIN Antibody
APR06855G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADROPIN . This antibody is tested and proven to work in the following applications:

Adropin (ENHO) Antibody
20-abx132167	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Adropin (ENHO) Protein
20-abx262645	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Hepatitis Surface Antigen subtype Ad (HBsAg Ad), Native (human plasma) purified
HBA26-N-100	Alpha Diagnostics	100 ug	EUR 225

HBsAg (Subtype Ad), Human Plasma
P1439-100	Biovision		EUR 180

HBsAg (Subtype Ad), Human Plasma
P1439-500	Biovision		EUR 533

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Virus Hepatitis B Virus Surface Antigen ad (HBsAg ad) Protein
abx670255-01mg	Abbexa	0.1 mg	EUR 704
Shipped within 1 week.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

HBsAg protein (subtype ad)
30-1815	Fitzgerald	500 ug	EUR 435
Description: Native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype ad)
30-AH15	Fitzgerald	1 mg	EUR 348
Description: Purified native Human HBsAg protein (Subtype ad)

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Adropin (34-76) (human, mouse, rat)
H-6686.0500	Bachem	0.5mg