Effects of ethyl acetate extract of Salsola collina on brain-gut peptides and interstitial cells

Comparability of two business ELISA kits for detection of rubella particular IgM in suspected congenital rubella syndrome circumstances and rubella IgG antibodies in a serosurvey of pregnant girls.

Enzyme linked immunosorbent assay (ELISA) for antibody identification, is necessary for laboratory affirmation of rubella an infection in numerous settings. The Enzygnost rubella ELISA, broadly used within the World Well being Group (WHO) World Measles and Rubella Laboratory Community, is dear and infrequently unavailable.

Qualitative and quantitative efficiency of the Euroimmun ELISA was in contrast with the Enzygnost ELISA, for detection of rubella particular IgM, utilizing 283 sera collected from suspected congenital rubella syndrome (CRS) sufferers and IgG antibodies utilizing 435 sera from a serosurvey amongst pregnant girls.

Good qualitative settlement was noticed for detection of each rubella particular IgM (94.7% settlement and κ of 0.86) and IgG (96.3% settlement and κ of 0.84). Bland-Altman evaluation for IgG yielded a imply distinction of 0.781 IU/ml with 97.1% values inside ±2 SD of the imply distinction.

Our examine findings recommend that Euroimmun ELISA could also be thought-about for detection of rubella particular IgM in suspected CRS circumstances and rubella particular IgG in surveillance research.



Human Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-Hu-96T 96T
EUR 621
  • Should the Human Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-p-48T 48T
EUR 547
  • Should the Porcine Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-p-96T 96T
EUR 715
  • Should the Porcine Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-Ra-48T 48T
EUR 508
  • Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

DLR-DAO-Ra-96T 96T
EUR 661
  • Should the Rat Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Hu-48Tests 48 Tests
EUR 500

Human Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Hu-96Tests 96 Tests
EUR 692

Porcine Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-p-48Tests 48 Tests
EUR 580

Porcine Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-p-96Tests 96 Tests
EUR 807

Rat Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Ra-48Tests 48 Tests
EUR 534

Rat Diamine Oxidase (DAO) ELISA Kit

RDR-DAO-Ra-96Tests 96 Tests
EUR 742

Human Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Hu-48Tests 48 Tests
EUR 478

Human Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Hu-96Tests 96 Tests
EUR 662

Porcine Diamine Oxidase (DAO) ELISA Kit

RD-DAO-p-48Tests 48 Tests
EUR 555

Porcine Diamine Oxidase (DAO) ELISA Kit

RD-DAO-p-96Tests 96 Tests
EUR 771

Rat Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Ra-48Tests 48 Tests
EUR 511

Rat Diamine Oxidase (DAO) ELISA Kit

RD-DAO-Ra-96Tests 96 Tests
EUR 709

Dao/ Rat Dao ELISA Kit

ELI-46592r 96 Tests
EUR 886


EMD0039 96Tests
EUR 521

DAO ELISA Kit (Mouse) (OKEH05527)

OKEH05527 96 Wells
EUR 779
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 39 pg/mL

Mouse diamine oxidase,DAO ELISA Kit

CN-02511M1 96T
EUR 436

Mouse diamine oxidase,DAO ELISA Kit

CN-02511M2 48T
EUR 287

Mouse diamine oxidase, DAO ELISA Kit

CSB-E10090m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse diamine oxidase, DAO ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse DAO(Diamine Oxidase) ELISA Kit

EM0980 96T
EUR 524.1
  • Detection range: 3.906-250 ng/ml
  • Uniprot ID: P18894
  • Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-48T 48T
EUR 336

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-96T 96T
EUR 534

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

SEA656Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Diamine Oxidase ELISA Kit (DAO)

RK02737 96 Tests
EUR 521

Mouse diamine oxidase(DAO)ELISA Kit

QY-E20470 96T
EUR 361


EHD0039 96Tests
EUR 521


ELA-E13922h 96 Tests
EUR 824


EGTD0039 96Tests
EUR 521

Bovine DAO ELISA Kit

EBD0039 96Tests
EUR 521

Canine DAO ELISA Kit

ECD0039 96Tests
EUR 521

Chicken DAO ELISA Kit

ECKD0039 96Tests
EUR 521

Anserini DAO ELISA Kit

EAD0039 96Tests
EUR 521


EF005669 96 Tests
EUR 689


ERD0039 96Tests
EUR 521


ESD0039 96Tests
EUR 521

Rabbit DAO ELISA Kit

ERTD0039 96Tests
EUR 521

Monkey DAO ELISA Kit

EMKD0039 96Tests
EUR 521

Porcine DAO ELISA Kit

EPD0039 96Tests
EUR 521

DAO ELISA Kit| Mouse Diamine Oxidase ELISA Kit

EF013561 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Mouse DAO (Diamine Oxidase)

E-EL-M0412 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse DAO (Diamine Oxidase)

ELK5316 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diamine oxidase (DAO)

KTE70533-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea Pig DAO ELISA Kit

EGD0039 96Tests
EUR 521

DAO ELISA Kit (Human) (OKAN05362)

OKAN05362 96 Wells
EUR 792
Description: Description of target: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

DAO ELISA Kit (Rat) (OKAN05493)

OKAN05493 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.236 ng/mL

DAO ELISA Kit (Rabbit) (OKCA00937)

OKCA00937 96 Wells
EUR 956
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 U/mL

DAO ELISA Kit (Rat) (OKCA00969)

OKCA00969 96 Wells
EUR 956
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.195 mIU/mL

DAO ELISA Kit (Human) (OKCD09181)

OKCD09181 96 Wells
EUR 975
Description: Description of target: Recombinant Human D-Amino Acid Oxidase ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.56ng/mL

DAO ELISA Kit (Pig) (OKEH07970)

OKEH07970 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Mouse Dao/ D-amino-acid oxidase ELISA Kit

E0378Mo 1 Kit
EUR 632

Mouse D- amino- acid oxidase, Dao ELISA KIT

ELI-16169m 96 Tests
EUR 865

Mouse Diamine Oxidase (DAO) CLIA Kit

abx195143-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dao ELISA Kit| Mouse D-amino-acid oxidase ELISA Kit

EF014627 96 Tests
EUR 689

Mouse DAO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DAO Recombinant Protein (Mouse)

RP127823 100 ug Ask for price

Human diamine oxidase,DAO ELISA Kit

201-12-0777 96 tests
EUR 440
  • This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Porcine diamine oxidase, DAO ELISA Kit

ELA-E0656p 96 Tests
EUR 928

Rat diamine oxidase, DAO ELISA Kit

ELA-E0656r 96 Tests
EUR 886

Bovine DAO(Diamine Oxidase) ELISA Kit

EB0118 96T
EUR 567.6
  • Detection range: 15.625-1000 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 9.375 ng/ml

Rat diamine oxidase(DAO) ELISA Kit

CSB-E12634r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase (DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat diamine oxidase(DAO) ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat diamine oxidase(DAO) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PoFAine diamine oxidase,DAO ELISA Kit

CN-01272P1 96T
EUR 447

PoFAine diamine oxidase,DAO ELISA Kit

CN-01272P2 48T
EUR 296

Human diamine oxidase,DAO ELISA Kit

CN-03719H1 96T
EUR 458

Human diamine oxidase,DAO ELISA Kit

CN-03719H2 48T
EUR 307

Human diamine oxidase, DAO ELISA Kit

CSB-E10137h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human diamine oxidase, DAO ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat DAO(Diamine Oxidase) ELISA Kit

ER0895 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: O35078
  • Alias: DAO
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 1.875 ng/ml

Human diamine oxidase(DAO)ELISA Kit

GA-E0793HM-48T 48T
EUR 289

Human diamine oxidase(DAO)ELISA Kit

GA-E0793HM-96T 96T
EUR 466

Rat diamine oxidase(DAO)ELISA Kit

GA-E0233RT-48T 48T
EUR 317

Rat diamine oxidase(DAO)ELISA Kit

GA-E0233RT-96T 96T
EUR 496

Porcine DAO(Diamine Oxidase) ELISA Kit

EP0047 96T
EUR 567.6
  • Detection range: 1.563-100 ng/ml
  • Alias: Amiloride-binding protein 1/Amine oxidase copper domain-containing protein 1/Histaminase/Kidney amine oxidase/KAO/ABP1/DAO1/AOC1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 0.938 ng/ml

Human diamine oxidase(DAO)ELISA Kit

QY-E03708 96T
EUR 361

Rat diamine oxidase(DAO)ELISA Kit

QY-E11419 96T
EUR 361

Goat diamine oxidase,DAO ELISA KIT

QY-E140016 96T
EUR 413

Human Diamine Oxidase ELISA Kit (DAO)

RK01242 96 Tests
EUR 521

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

SEA656Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

SEA656Po-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Pig Diamine Oxidase (DAO) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Pig Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

SEA656Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diamine Oxidase (DAO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Diamine Oxidase (DAO) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Porcine Diamine Oxidase ELISA Kit (DAO)

RK03313 96 Tests
EUR 521

Rat Diamine Oxidase ELISA Kit (DAO)

RK03613 96 Tests
EUR 521

Porcine diamine oxidase (DAO) ELISA Kit

QY-E40051 96T
EUR 400

Canine diamine oxidase,DAO ELISA Kit

QY-E70001 96T
EUR 426

DAO ELISA Kit| Rat Diamine Oxidase ELISA Kit

EF017679 96 Tests
EUR 689

DAO ELISA Kit| Porcine Diamine Oxidase ELISA Kit

EF016588 96 Tests
EUR 689

DAO Antibody

32763-100ul 100ul
EUR 252

DAO Antibody

DF7266 200ul
EUR 304
Description: DAO Antibody detects endogenous levels of total DAO.

DAO Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAO. Recognizes DAO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:500


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAO Antibody

ABD7266 100 ug
EUR 438

Mouse D-Amino Acid Oxidase/ DAMOX (DAO) ELISA Kit

abx516676-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

CLIA kit for Mouse DAO (Diamine Oxidase)

E-CL-M0259 1 plate of 96 wells
EUR 584
  • Gentaur's DAO CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse DAO . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Diamine Oxidase (DAO) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Diamine Oxidase (DAO) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dao ORF Vector (Mouse) (pORF)

ORF042609 1.0 ug DNA
EUR 506

ELISA kit for Human DAO (Diamine Oxidase)

E-EL-H1241 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DAO. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat DAO (Diamine Oxidase)

E-EL-R0331 1 plate of 96 wells
EUR 534
  • Gentaur's DAO ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat DAO. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat DAO (Diamine Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DAO (Diamine Oxidase)

ELK4306 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to D-Amino Acid Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D-Amino
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DAO (Diamine Oxidase)

ELK1773 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat DAO (Diamine Oxidase)

ELK2230 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig DAO (Diamine Oxidase)

ELK5633 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diamine Oxidase (DAO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diamine Oxid
  • Show more
Description: A sandwich ELISA kit for detection of Diamine Oxidase from Pig in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Diamine oxidase (DAO)

KTE100901-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-48T 48T
EUR 354
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-5platesof96wells 5 plates of 96 wells
EUR 2252
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Diamine oxidase (DAO)

KTE80174-96T 96T
EUR 572
  • On the basis of its primary structure, the amiloride-binding protein (EC is 713 amino acids long, with a 19-amino acid signal peptide. Expressed in cultured cells, the mRNA yields a glycoprotein that binds amiloride and amiloride analogs wit
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Diamine oxidase (DAO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DAO Chemi-Luminescent ELISA Kit (Human) (OKCD03409)

OKCD03409 96 Wells
EUR 988
Description: Description of target: Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

DAO ELISA Kit (Human) : 96 Wells (OKEH02323)

OKEH02323 96 Wells
EUR 740
Description: Description of target: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38 pg/mL

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

DAO Blocking Peptide

DF7266-BP 1mg
EUR 195

DAO Conjugated Antibody

C32763 100ul
EUR 397

DAO cloning plasmid

CSB-CL006494HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atgcgtgtggtggtgattggagcaggagtcatcgggctgtccaccgccctctgcatccatgagcgctaccactcagtcctgcagccactggacataaaggtctacgcggaccgcttcaccccactcaccaccaccgacgtggctgccggcctctggcagccctacctttctgacc
  • Show more
Description: A cloning plasmid for the DAO gene.

DAO Polyclonal Antibody

A50181 100 µg
EUR 570.55
Description: Ask the seller for details

DAO Rabbit pAb

A5309-100ul 100 ul
EUR 308

DAO Rabbit pAb

A5309-200ul 200 ul
EUR 459

DAO Rabbit pAb

A5309-20ul 20 ul
EUR 183

DAO Rabbit pAb

A5309-50ul 50 ul
EUR 223

anti- DAO antibody

FNab02235 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: D-amino-acid oxidase
  • Uniprot ID: P14920
  • Gene ID: 1610
  • Research Area: Metabolism
Description: Antibody raised against DAO

Anti-DAO antibody

PAab02235 100 ug
EUR 355

Anti-DAO antibody

STJ27262 100 µl
EUR 277
Description: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia.

Dao ELISA Kit| Rat D-amino-acid oxidase ELISA Kit

EF018550 96 Tests
EUR 689

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human D-Amino Acid Oxidase (DAO) ELISA Kit

EUR 517
  • Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

EUR 673
  • Should the Human D-Amino Acid Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human D-Amino Acid Oxidase (DAO) in samples from tissue homogenates or other biological fluids.

Human DAO/ D-amino-acid oxidase ELISA Kit

E0656Hu 1 Kit
EUR 605

Human DAO(D-amino-acid oxidase) ELISA Kit

EH1546 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P14920
  • Alias: DAO(D-amino-acid oxidase)/DAAO/DAMOX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Rabbit D- amino- acid oxidase, DAO ELISA KIT

ELI-23339Ra 96 Tests
EUR 928

Porcine D- amino- acid oxidase, DAO ELISA KIT

ELI-46591p 96 Tests
EUR 928

Human D- amino- acid oxidase, DAO ELISA KIT

ELI-35545h 96 Tests
EUR 824

Human D-Amino Acid Oxidase ELISA Kit (DAO)

RK01243 96 Tests
EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RDR-DAMOX-Hu-48Tests 48 Tests
EUR 544

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RDR-DAMOX-Hu-96Tests 96 Tests
EUR 756

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RD-DAMOX-Hu-48Tests 48 Tests
EUR 521

Human D-Amino Acid Oxidase (DAO) ELISA Kit

RD-DAMOX-Hu-96Tests 96 Tests
EUR 723

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

SEJ298Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human D-Amino Acid Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human D-Amino Acid Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Human D-Amino Acid Oxidase (DAO) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as D-Amino Acid Oxidase elisa. Alternative names of the recognized antigen: DAMOX
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human D-Amino Acid Oxidase (DAO) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Dao sgRNA CRISPR Lentivector set (Mouse)

K3771901 3 x 1.0 ug
EUR 339

Diamine Oxidase (DAO) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAO (His292~Asn460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diamine Oxidase (DAO)

Diamine Oxidase (DAO) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAO (Arg197~Trp322)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diamine Oxidase (DAO)

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Human Diamine Oxidase (DAO) CLIA Kit

abx195142-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Diamine Oxidase (DAO) CLIA Kit

abx195144-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Diamine Oxidase (DAO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Pig Diamine Oxidase (DAO) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Diamine Oxidase (DAO) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.


Zika virus seroprevalence in girls who gave start throughout Zika virus outbreak in Brazil – a potential observational examine


Background: The current Zika virus (ZIKV) outbreak in Brazil began in August 2015 and resulted in Might 2017 with out efficient public well being measures for its management have been taken. The immunological standing of a group could not solely predict future outbreaks as properly to reply questions concerning ZIKV not identified but.


Goal: To confirm the seroprevalence of ZIKV in a bunch of ladies who had been pregnant in the course of the Zika virus outbreak in Recife, three to 9 months after the supply, and to guage the neurodevelopment of their youngsters.


Strategies: A cross-sectional examine enrolled individuals of a cohort examine held at Instituto de Medicina Integral Professor Fernando Figueira (IMIP) in the course of the ZIKV outbreak in Recife. Moms who gave start between the final trimester of 2015 and the primary semester of 2016, interval of the height of microcephaly outbreak in Recife, had been invited. All individuals had the serum examined by the anti-ZIKV IgG/IgM enzyme-liked immunosorbent assays, ELISA equipment (Euroimmun, Lübeck, Germany). All youngsters whose moms offered constructive serology for ZIKV carried out the IgG/IgM ELISA take a look at for ZIKV. These youngsters had been additionally evaluated by a neuropediatrician and the Denver II improvement screening take a look at was utilized.


Outcomes: Among the many 132 studied pregnant girls who gave start on the peak of ZIKV outbreak in Recife, all had been ZIKV IgM destructive and 81 (61,3%) had ZIKV IgG constructive. Moms ZIKV IgG constructive had extra fever and rash in the course of the being pregnant as in contrast with moms destructive for ZIKV; respectively 27/81 (33,3%) vs 6/51 (11,7%), p = 0.005 and 22/81 (27,2%) vs 4 (7,8%), p = 0.016. Just one baby had IgG constructive serology for ZIKV. No youngsters had neurodevelopment defect for the age group and the Denver II regular scores.


Conclusions: A excessive ZIKV IgG seroprevalence in pregnant girls on the finish of the ZIKV outbreak in Recife was discovered. This discovering means that group protecting immunity could have contributed to the tip of ZIKV outbreak in Recife, Brazil.

Results of ethyl acetate extract of Salsola collina on brain-gut peptides and interstitial cells of gastric Cajal in rats with diabetic gastroparesis


Goals: Results of ethyl acetate extract of Salsola collina (EES) on brain-gut peptides and interstitial cells of gastric Cajal in rats with diabetic gastroparesis had been explored.


Supplies and strategies: Rats had been divided into six teams: regular management group (NC), diabetic gastroparesis mannequin group (DGP), low, medium, and excessive dose of EES teams (LES, MES, and HES, respectively), and metoclopramide constructive group (MPG). DGP rats had been induced by streptozotocin (STZ) mixed with a high-sugar-high-fat eating regimen.


The gastric emptying was measured by the phenol purple labeling methodology. Enzyme-linked immunosorbent assay (ELISA) was employed to find out the concentrations of serum ghrelin, gastrin (GAS), somatostatin (SS), and vasoactive intestinal peptide (VIP). The expressions of c-Package and its pure ligand stem cell issue (SCF) in gastric tissues had been decided by Western blot and immunofluorescence.


Outcomes: Gastric emptying fee elevated in a special diploma after intervention by EES, amongst which MES and HES teams confirmed a big impact (in contrast with DGP, P<0.01) and the HES group was equal to the MPG group; serum ghrelin and content material of serum GAS elevated whereas SS and VIP decreased (in contrast with the DGP group, P<0.05 or P<0.01); c-Package and SCF protein expressions in gastric tissue elevated (in contrast with DGP group, P<0.05 or P<0.01).

Conclusion: EES considerably improved gastric emptying by regulating gastrointestinal hormone excretion and c-Package/SCF signaling pathway. Our examine gives a pharmacological foundation for using the EES within the remedy of DGP. Nonetheless, the detailed molecular mechanism stays to be clarified.

Human Adropin (AD) ELISA Kit

RD-AD-Hu-96Tests 96 Tests
EUR 783

Human Adropin (AD) ELISA Kit

RDR-AD-Hu-48Tests 48 Tests
EUR 589

Human Adropin (AD) ELISA Kit

RDR-AD-Hu-96Tests 96 Tests
EUR 820

Human adropin(AD) ELISA kit

E01A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adropin(AD) ELISA kit

E01A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adropin(AD) ELISA kit

E01A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin ELISA Kit (AD)

RK00809 96 Tests
EUR 521

Human Adropin(AD)ELISA Kit

QY-E05167 96T
EUR 400

Human Adropin (AD) ELISA Kit

SEN251Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit

SEN251Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit

SEN251Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit

SEN251Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Human Adropin (AD) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO
  • UNQ470
  • Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Goat adropin(AD) ELISA kit

E06A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adropin(AD) ELISA kit

E06A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adropin(AD) ELISA kit

E06A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit

E02A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit

E02A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adropin(AD) ELISA kit

E02A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit

E03A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit

E03A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adropin(AD) ELISA kit

E03A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit

E04A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit

E04A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adropin(AD) ELISA kit

E04A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit

E08A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit

E08A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adropin(AD) ELISA kit

E08A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit

E07A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit

E07A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adropin(AD) ELISA kit

E07A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit

E09A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit

E09A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adropin(AD) ELISA kit

E09A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AD(Adropin) ELISA Kit

ER1459 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: AD/ENHO/Energy homeostasis-associated protein/Adropin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Adropin ELISA Kit (AD)

RK02568 96 Tests
EUR 521

Mouse Adropin (AD) ELISA Kit

SEN251Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit

SEN251Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit

SEN251Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit

SEN251Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Adropin (AD) ELISA Kit

  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO
  • UNQ470
  • Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Adropin (AD) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adropin (AD) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Adropin (AD)

  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6UWT2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 8.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adropin expressed in: E.coli

Recombinant Adropin (AD)

  • EUR 565.92
  • EUR 254.00
  • EUR 1847.20
  • EUR 682.40
  • EUR 1264.80
  • EUR 442.00
  • EUR 4468.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 8.2kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Adropin expressed in: E.coli

ELISA kit for Human AD (Adropin)

E-EL-H5307 1 plate of 96 wells
EUR 534
  • Gentaur's AD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AD. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AD (Adropin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human AD (Adropin)

ELK6444 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adropin (AD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adropin (AD). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Adropin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adropin (AD)

KTE60907-48T 48T
EUR 354
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adropin (AD)

KTE60907-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adropin (AD)

KTE60907-96T 96T
EUR 572
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea pig adropin(AD) ELISA kit

E05A1239-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig adropin(AD) ELISA kit

E05A1239-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig adropin(AD) ELISA kit

E05A1239-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig adropin(AD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse AD (Adropin)

ELK8097 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adropin (AD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adropin (AD). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Adropin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Adropin (AD)

KTE101165-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Adropin (AD)

KTE101165-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Adropin (AD)

KTE101165-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Adropin (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit

HEN251Hu-1x96wellstestplate 1x96-wells test plate
EUR 752.19
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit

HEN251Hu-5x96wellstestplate 5x96-wells test plate
EUR 3084.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit

  • EUR 5744.00
  • EUR 3035.00
  • EUR 753.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adropin elisa. Alternative names of the recognized antigen: ENHO
  • UNQ470
  • Energy Homeostasis Associated Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Adropin (AD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

High Sensitive Human Adropin (AD) ELISA Kit

HEN251Hu-10x96wellstestplate 10x96-wells test plate
EUR 5693.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

High Sensitive Human Adropin (AD) ELISA Kit

HEN251Hu-1x48wellstestplate 1x48-wells test plate
EUR 556.53
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Adropin (AD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adropin (AD) in serum, plasma, tissue homogenates and other biological fluids.

AD ELISA Kit| Rat Adropin ELISA Kit

EF018137 96 Tests
EUR 689

Adropin (AD) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD)

ELISA kit for Rat AD (Adropin)  Kit

E-EL-R2566 1 plate of 96 wells
EUR 534
  • Gentaur's AD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AD. Standards or samples are added to the micro ELISA plate wells and combined with the spec
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat AD (Adropin)  Kit in samples from Serum, Plasma, Cell supernatant

Adropin (AD) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with APC.

Adropin (AD) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with Biotin.

Adropin (AD) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with Cy3.

Adropin (AD) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with FITC.

Adropin (AD) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with HRP.

Adropin (AD) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with PE.

Adropin (AD) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Cys34~Pro76
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adropin (AD). This antibody is labeled with APC-Cy7.

Human amiodarone(AD)ELISA Kit

GA-E1909HM-48T 48T
EUR 289

Human amiodarone(AD)ELISA Kit

GA-E1909HM-96T 96T
EUR 466

Human amiodarone,AD ELISA Kit

201-12-1893 96 tests
EUR 440
  • This amiodarone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human amiodarone,AD ELISA Kit

CN-04509H1 96T
EUR 438

Human amiodarone,AD ELISA Kit

CN-04509H2 48T
EUR 289

Human amiodarone(AD)ELISA Kit

QY-E00477 96T
EUR 361

Human Adropin(ENHO) ELISA kit

E01A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin(ENHO) ELISA kit

E01A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adropin(ENHO) ELISA kit

E01A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Adropin

EK4627 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adropin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ENHO/ Adropin ELISA Kit

E0790Hu 1 Kit
EUR 571

Human ENHO(Adropin) ELISA Kit

EH2290 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q6UWT2
  • Alias: ENHO/Energy homeostasis-associated protein/Adropin
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Adropin, ENHO ELISA KIT

ELI-26910h 96 Tests
EUR 824

Human Adropin(ENHO) ELISA kit

CSB-EL007669HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adropin (ENHO) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Adropin(ENHO) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adropin(ENHO) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse adropin ELISA Kit

EM1805 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

ELISA kit for Human Amiodarone (AD)

KTE62672-48T 48T
EUR 354
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Amiodarone (AD)

KTE62672-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Amiodarone (AD)

KTE62672-96T 96T
EUR 572
  • Adropin, a recently described endogenous neuroendocrine peptide, has been suggested to play a critical role in modulating normal physiological processes and maintaining metabolic homeostasis. Adropin (10 ng/mL) caused a marked 10-fold increase in end
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Amiodarone (AD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Enho/ Adropin ELISA Kit

E0464Mo 1 Kit
EUR 571

Goat Adropin(ENHO) ELISA kit

E06A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adropin(ENHO) ELISA kit

E06A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adropin(ENHO) ELISA kit

E06A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit

E03A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit

E03A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adropin(ENHO) ELISA kit

E03A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit

E04A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit

E04A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adropin(ENHO) ELISA kit

E04A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit

E02A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit

E02A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adropin(ENHO) ELISA kit

E02A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit

E07A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit

E07A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adropin(ENHO) ELISA kit

E07A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit

E09A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit

E09A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adropin(ENHO) ELISA kit

E09A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit

E08A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit

E08A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adropin(ENHO) ELISA kit

E08A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Adropin, ENHO ELISA KIT

ELI-27671b 96 Tests
EUR 928

Mouse Adropin, Enho ELISA KIT

ELI-32795m 96 Tests
EUR 865

Mouse Adropin(ENHO) ELISA kit

CSB-EL007669MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Adropin (ENHO) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Adropin(ENHO) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Adropin(ENHO) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant human Adropin

P1700 100ug Ask for price
  • Uniprot ID: Q6UWT2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Adropin

Enho ELISA Kit| Mouse Adropin ELISA Kit

EF014792 96 Tests
EUR 689

ENHO ELISA Kit| Bovine Adropin ELISA Kit

EF011352 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

AD 0261

HY-U00005 10mg
EUR 3700


PVT4018 2 ug
EUR 266

Guinea pig Adropin(ENHO) ELISA kit

E05A1849-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adropin(ENHO) ELISA kit

E05A1849-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adropin(ENHO) ELISA kit

E05A1849-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adropin(ENHO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse AD Protein

  • EUR 787.00
  • EUR 300.00
  • EUR 2486.00
  • EUR 940.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Valrubicin (AD-32)

EUR 746

Valrubicin (AD-32)

EUR 224

HBsAg ad Protein

abx060555-100ug 100 ug
EUR 878
  • Shipped within 5-10 working days.

Polyclonal ADROPIN Antibody

APR06855G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADROPIN . This antibody is tested and proven to work in the following applications:

Adropin (ENHO) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adropin (ENHO) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Hepatitis Surface Antigen subtype Ad (HBsAg Ad), Native (human plasma) purified

HBA26-N-100 100 ug
EUR 225

HBsAg (Subtype Ad), Human Plasma

EUR 180

HBsAg (Subtype Ad), Human Plasma

EUR 533

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Virus Hepatitis B Virus Surface Antigen ad (HBsAg ad) Protein

abx670255-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

HBsAg protein (subtype ad)

30-1815 500 ug
EUR 435
Description: Native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype ad)

30-AH15 1 mg
EUR 348
Description: Purified native Human HBsAg protein (Subtype ad)

PCR Mycoplasma Detection Kit
