etrandrine mediates renal function and redox homeostasis

Protecting Results of Crocetin in opposition to Radiation-Induced Damage in Intestinal Epithelial Cells

 

Background and goals: Therapy choices for radiation-induced intestinal damage (RIII) are restricted. Crocetin has been demonstrated to exert antioxidant, antiapoptotic, and anti inflammatory results on varied ailments. Right here, we examine the results of crocetin on RIII in vitro. Supplies and Methodology. IEC-6 cells uncovered to 10 Gy of radiation have been handled with totally different doses of crocetin (0, 0.1, 1, 10, and 100 μM), and cell viability was assessed by CCK-8.

 

The degrees of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), malondialdehyde (MDA), myeloperoxidase (MPO), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interferon-γ (IFN-γ) in tradition supernatants have been measured utilizing colorimetric and ELISA kits, respectively. Mobile apoptosis was evaluated by Annexin V/PI double staining.

 

Outcomes: Crocetin dose-dependently improved the survival of irradiated IEC-6 cells with the optimum dose of 10 μM, as indicated by the discount of mobile apoptosis, decreased ranges of MDA, MPO, and proinflammatory cytokines (TNF-α, IL-1β, and IFN-γ), and elevated actions of antioxidative enzymes (SOD, CAT, and GPx).

Human Mucin 7, Secreted (MUC7) ELISA Kit
DLR-MUC7-Hu-96T	DL Develop	96T	EUR 647
Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Mucin-7,MUC7 ELISA Kit
201-12-1614	SunredBio	96 tests	EUR 440
This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human MUC7/ Mucin-7 ELISA Kit
E1675Hu	Sunlong	1 Kit	EUR 571

Human MUC7(Mucin-7) ELISA Kit
EH1942	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q8TAX7 Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- 7, MUC7 ELISA KIT
ELI-05843h	Lifescience Market	96 Tests	EUR 824

Human Mucin-7, MUC7 ELISA Kit
CSB-E11853h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-7, MUC7 ELISA Kit
1-CSB-E11853h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-48T	GenAsia Biotech	48T	EUR 289

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-96T	GenAsia Biotech	96T	EUR 466

Human Mucin-7(MUC7)ELISA Kit
QY-E00294	Qayee Biotechnology	96T	EUR 361

Mucin 7 (MUC7) Antibody
abx216981-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody
20-abx210446	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody
20-abx210681	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human MUC7 (Mucin 7)
E-EL-H2281	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

Human Mucin-7, Secreted (MUC7) ELISA Kit
20-abx152403	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit
abx251263-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit
abx572156-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-48T	Abbkine	48T	EUR 354
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-96T	Abbkine	96T	EUR 572
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Mucin 7, Secreted ELISA Kit (MUC7)
RK01900	Abclonal	96 Tests	EUR 521

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
4-SEB808Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mucin 7, Secreted elisa. Alternative names of the recognized antigen: MG2 Mucin 7, Salivary Apo-MG2 Salivary mucin-7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Mucin 7 (MUC7) CLIA Kit
abx197312-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Mouse MUC7 (Mucin-7)
E-EL-M0801	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse MUC7 (Mucin-7) in samples from Serum, Plasma, Cell supernatant

Pig Mucin-7, Secreted (MUC7) ELISA Kit
abx361133-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Mucin-7, Secreted (MUC7) ELISA Kit
abx363009-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Mucin-7, Secreted (MUC7) ELISA Kit
abx350994-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Mucin-7, Secreted (MUC7) ELISA Kit
abx355984-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Mucin-7, Secreted (MUC7) ELISA Kit
abx359170-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-48T	Abbkine	48T	EUR 332
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-96T	Abbkine	96T	EUR 539
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Mucin-7(MUC7)ELISA Ki
GA-E0485MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Mucin-7(MUC7)ELISA Ki
GA-E0485MS-96T	GenAsia Biotech	96T	EUR 534

ELISA kit for Human MUC7 (Mucin 7, Secreted)
ELK2203	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 7, Secreted (MUC7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 7, Show more
Description: A sandwich ELISA kit for detection of Mucin 7, Secreted from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mucin 7, Secreted (MUC7) Antibody
20-abx177629	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Mucin 7, Secreted (MUC7) Antibody
20-abx177630	Abbexa	EUR 1358.00 EUR 648.00	1 mg 200 ug
Please enquire.

Mucin 7, Secreted (MUC7) Antibody
20-abx173632	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Recombinant Mucin 7, Secreted (MUC7)
4-RPB808Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 66.8kDa Isoelectric Point: 8.2
Description: Recombinant Human Recombinant Mucin 7, Secreted (MUC7) expressed in: E.coli

CLIA kit for Human MUC7 (Mucin 7)
E-CL-H1342	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MUC7 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

Human Mucin-7, Secreted (MUC7) CLIA Kit
20-abx493103	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Mucin 7, Secreted (MUC7) Protein
20-abx654412	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Guinea pig Mucin-7, Secreted (MUC7) ELISA Kit
abx357346-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Mucin 7 ELISA kit
E01M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MUC7 ELISA Kit
ELA-E1808h	Lifescience Market	96 Tests	EUR 824

Human MUC7 ELISA Kit
EHM0361	Abclonal	96Tests	EUR 521

MUC7 ELISA KIT|Human
EF006051	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Mucin-7
EK3979	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Mucin 7 ELISA kit
E02M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit
E02M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit
E02M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit
E04M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit
E04M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit
E04M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit
E03M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit
E03M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit
E03M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit
E06M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit
E06M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit
E06M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit
E08M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit
E08M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit
E08M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit
E07M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit
E07M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit
E07M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit
E09M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit
E09M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit
E09M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine MUC7 ELISA Kit
EBM0361	Abclonal	96Tests	EUR 521

Anserini MUC7 ELISA Kit
EAM0361	Abclonal	96Tests	EUR 521

Chicken MUC7 ELISA Kit
ECKM0361	Abclonal	96Tests	EUR 521

Canine MUC7 ELISA Kit
ECM0361	Abclonal	96Tests	EUR 521

Goat MUC7 ELISA Kit
EGTM0361	Abclonal	96Tests	EUR 521

Porcine MUC7 ELISA Kit
EPM0361	Abclonal	96Tests	EUR 521

Sheep MUC7 ELISA Kit
ESM0361	Abclonal	96Tests	EUR 521

Rat MUC7 ELISA Kit
ERM0361	Abclonal	96Tests	EUR 521

Rabbit MUC7 ELISA Kit
ERTM0361	Abclonal	96Tests	EUR 521

Monkey MUC7 ELISA Kit
EMKM0361	Abclonal	96Tests	EUR 521

Mouse MUC7 ELISA Kit
EMM0361	Abclonal	96Tests	EUR 521

Guinea pig Mucin 7 ELISA kit
E05M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit
E05M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit
E05M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig MUC7 ELISA Kit
EGM0361	Abclonal	96Tests	EUR 521

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Hu-48T	DL Develop	48T	EUR 501
Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Hu-96T	DL Develop	96T	EUR 651
Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 503

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 697

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 525

Human Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 729

MUC7 Antibody
43220-100ul	SAB	100ul	EUR 252

MUC7 Antibody
1-CSB-PA949093	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC7 Antibody
1-CSB-PA780399	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MUC7 Antibody
DF9642	Affbiotech	200ul	EUR 304
Description: MUC7 Antibody detects endogenous levels of total MUC7.

MUC7 siRNA
20-abx925029	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUC7 Antibody
ABD9642	Lifescience Market	100 ug	EUR 438

anti-MUC7
YF-PA24185	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MUC7

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human MUC7 shRNA Plasmid
20-abx953023	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUC7 Recombinant Protein (Human)
RP020392	ABM	100 ug	Ask for price

Anti-MUC7 Antibody
A05210	BosterBio	100ug/vial	EUR 294

MUC7 Blocking Peptide
DF9642-BP	Affbiotech	1mg	EUR 195

MUC7 Conjugated Antibody
C43220	SAB	100ul	EUR 397

MUC7 cloning plasmid
CSB-CL851529HU-10ug	Cusabio	10ug	EUR 427
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1134 Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca Show more
Description: A cloning plasmid for the MUC7 gene.

MUC7 Polyclonal Antibody
ABP59345-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody
ABP59345-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody
ABP59345-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody
ES9828-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC7 Polyclonal Antibody
ES9828-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MUC7 antibody
STJ190986	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MUC7

Anti-MUC7 (7F2)
YF-MA10594	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MUC7

Anti-MUC7 (1C10)
YF-MA14331	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MUC7

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-c-48T	DL Develop	48T	EUR 560
Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-c-96T	DL Develop	96T	EUR 732
Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Mu-48T	DL Develop	48T	EUR 512
Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Mu-96T	DL Develop	96T	EUR 667
Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Ra-48T	DL Develop	48T	EUR 536
Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
DLR-Ang1-7-Ra-96T	DL Develop	96T	EUR 700
Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-c-48Tests	Reddot Biotech	48 Tests	EUR 569

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-c-96Tests	Reddot Biotech	96 Tests	EUR 792

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Mu-48Tests	Reddot Biotech	48 Tests	EUR 516

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Mu-96Tests	Reddot Biotech	96 Tests	EUR 716

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Ra-48Tests	Reddot Biotech	48 Tests	EUR 543

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
RD-Ang1-7-Ra-96Tests	Reddot Biotech	96 Tests	EUR 754

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-c-48Tests	Reddot Biotech	48 Tests	EUR 595

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-c-96Tests	Reddot Biotech	96 Tests	EUR 829

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Mu-48Tests	Reddot Biotech	48 Tests	EUR 539

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Mu-96Tests	Reddot Biotech	96 Tests	EUR 749

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Ra-48Tests	Reddot Biotech	48 Tests	EUR 567

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit
RDR-Ang1-7-Ra-96Tests	Reddot Biotech	96 Tests	EUR 789

Recombinant Human Galectin-7
7-00442	CHI Scientific	2µg	Ask for price

Recombinant Human Galectin-7
7-00443	CHI Scientific	10µg	Ask for price

Recombinant Human Galectin-7
7-00444	CHI Scientific	1mg	Ask for price

Recombinant Human Interleukin-7
7-00895	CHI Scientific	2µg	Ask for price

Recombinant Human Interleukin-7
7-00896	CHI Scientific	10µg	Ask for price

Recombinant Human Interleukin-7
7-00897	CHI Scientific	1mg	Ask for price

Recombinant Human Kallikrein-7
7-03034	CHI Scientific	2µg	Ask for price

Recombinant Human Kallikrein-7
7-03035	CHI Scientific	10µg	Ask for price

Recombinant Human Kallikrein-7
7-03036	CHI Scientific	100µg	Ask for price

Human Mucin 2 ELISA kit
E01M0352-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 17 ELISA Kit
ELA-E0403h	Lifescience Market	96 Tests	EUR 824

Human Gastric Mucin ELISA Kit
ELA-E1335h	Lifescience Market	96 Tests	EUR 824

Human Mucin (MUC) ELISA Kit
20-abx585162	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin (MUC) ELISA Kit
SES095Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Prevalence of SARS-CoV-2 an infection in India: Findings from the nationwide serosurvey, Might-June 2020

 

Background & goals: Inhabitants-based seroepidemiological research measure the extent of SARS-CoV-2 an infection in a rustic. We report the findings of the primary spherical of a nationwide serosurvey, carried out to estimate the seroprevalence of SARS-CoV-2 an infection amongst grownup inhabitants of India.

 

Strategies: From Might 11 to June 4, 2020, a randomly sampled, community-based survey was carried out in 700 villages/wards, chosen from the 70 districts of the 21 States of India, categorized into 4 strata based mostly on the incidence of reported COVID-19 circumstances. 4 hundred adults per district have been enrolled from 10 clusters with one grownup per family. Serum samples have been examined for IgG antibodies utilizing COVID Kavach ELISA package.

 

All constructive serum samples have been re-tested utilizing Euroimmun SARS-CoV-2 ELISA. Adjusting for survey design and serial check efficiency, weighted seroprevalence, variety of infections, an infection to case ratio (ICR) and an infection fatality ratio (IFR) have been calculated. Logistic regression was used to find out the elements related to IgG positivity.

 

Outcomes: Whole of 30,283 households have been visited and 28,000 people have been enrolled. Inhabitants-weighted seroprevalence after adjusting for check efficiency was 0.73 per cent [95% confidence interval (CI): 0.34-1.13]. Males, dwelling in city slums and occupation with excessive threat of publicity to doubtlessly contaminated individuals have been related to seropositivity.

 

A cumulative 6,468,388 grownup infections (95% CI: 3,829,029-11,199,423) have been estimated in India by the early Might. The general ICR was between 81.6 (95% CI: 48.3-141.4) and 130.1 (95% CI: 77.0-225.2) with Might 11 and Might 3, 2020 as believable reference factors for reported circumstances. The IFR within the surveyed districts from excessive stratum, the place dying reporting was extra strong, was 11.72 (95% CI: 7.21-19.19) to 15.04 (9.26-24.62) per 10,000 adults, utilizing Might 24 and June 1, 2020 as believable reference factors for reported deaths.

 

Interpretation & conclusions: Seroprevalence of SARS-CoV-2 was low among the many grownup inhabitants in India across the starting of Might 2020. Additional nationwide and native serosurveys are really useful to raised inform the general public well being technique for containment and mitigation of the epidemic in varied elements of the nation.

Tetrandrine mediates renal operate and redox homeostasis in a streptozotocin-induced diabetic nephropathy rat mannequin by Nrf2/HO-1 reactivation

 

Background: Diabetic nephropathy (DN) is the main reason for morbidity and mortality in diabetic sufferers. Tetrandrine (Tet), a bisbenzylisoquinoline alkaloid remoted from the roots of Stephania tetrandra, possesses anti-oxidative, anti-hypertensive, anti-inflammatory capacities. On this examine, the upkeep function of Tet in DN was evaluated in streptozotocin (STZ)-induced diabetic rats.

 

Strategies: In vitro examine, rats have been divided into 5 teams (n=10): the management group, the DN mannequin group, the Tet-treatment group (5, 15, 30 mg/kg). DN harm was assessed by ranges of blood glucose, serum creatinine (CRE), proteinuria, and urea nitrogen. ELISA assay was used to detecte tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6) and IL-10 ranges.

 

Kits have been used to detecte contents of malondialdehyde (MDA), lactate dehydrogenase (LDH) and superoxide dismutase (SOD). Dichlorofluorescein (DCF) staining was used to detecte reactive oxygen species (ROS). HE staining assessed pathological harm. TUNEL staining assessed tissue apoptosis. Western Blot (WB) was used to detecte ranges of Ki67, Survivin, Bax, Bcl-2, caspase-3, -9, c-Myc, nuclear issue erythroid-derived 2-related issue 2 (Nrf2), p-Nrf2, and heme oxygenase-1 (HO-1).

 

Outcomes: In contrast with the management group, STZ-induced considerably inhibited proliferation proteins’ stage, activated oxidative stress, aggravated tissue irritation and promoted tissue apoptosis. STZ-induced additional aggravated DN harm. Of word, these anomalies have been restored by Tet pretreatment. Moreover, Tet upgraded the expression of p-Nrf2 and HO-1.

 

Conclusions: These outcomes indicated that Tet might considerably restrain diabetic course of and renal harm. Tet is a possible therapeutic agent in DN remedy through the reactivation of the Nrf2/HO-1.

 

 

 

Creatinine (Cr) ELISA Kit
abx257719-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Cr(Creatinine) ELISA Kit
EH4306	FN Test	96T	EUR 476.25
Detection range: 1.25-80nmol/ml Alias: Creatinine
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75nmol/ml

Bovine Cr(Creatinine) ELISA Kit
EB0090	FN Test	96T	EUR 567.6
Detection range: 1.25-80nmol/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Cattle;Sensitivity: 0.75nmol/ml

General Creatinine, Cr ELISA KIT
ELI-07047Ge	Lifescience Market	96 Tests	EUR 886

Human Creatinine(Cr)ELISA Kit
GA-E1106HM-48T	GenAsia Biotech	48T	EUR 289

Human Creatinine(Cr)ELISA Kit
GA-E1106HM-96T	GenAsia Biotech	96T	EUR 466

Rat Creatinine(Cr)ELISA Kit
GA-E0315RT-48T	GenAsia Biotech	48T	EUR 317

Rat Creatinine(Cr)ELISA Kit
GA-E0315RT-96T	GenAsia Biotech	96T	EUR 496

Rat Cr(Creatinine) ELISA Kit
ER0864	FN Test	96T	EUR 524.1
Detection range: 1.25-80nmol/ml Alias: Cr
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.75nmol/ml

Mouse Cr(Creatinine) ELISA Kit
EM0950	FN Test	96T	EUR 524.1
Detection range: 1.25-80nmol/ml Alias: Cr
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 0.75nmol/ml

Human Creatinine,Cr ELISA Kit
201-12-1090	SunredBio	96 tests	EUR 440
This Creatinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

General Cr/ Creatinine ELISA Kit
E0017Ge	Sunlong	1 Kit	EUR 563

ELISA kit for Cr (Creatinine)
E-EL-0058	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's Cr ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Cr. During the reaction, Cr in the sample or standard competes with a fixed amount of Cr on the solid phase supporter Show more
Description: A competitive ELISA kit for quantitative measurement of Cr (Creatinine) in samples from Serum, Plasma, Cell supernatant

Human Creatinine(Cr)ELISA Kit
QY-E03067	Qayee Biotechnology	96T	EUR 361

Rat Creatinine(Cr)ELISA Kit
QY-E11337	Qayee Biotechnology	96T	EUR 361

Mouse Creatinine(Cr)ELISA Kit
QY-E20401	Qayee Biotechnology	96T	EUR 361

Creatinine (Cr) CLIA Kit
abx197924-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Human Creatinine (Cr)
KTE62273-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Creatinine (Cr)
KTE62273-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Creatinine (Cr)
KTE62273-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cr ELISA Kit| Rat Creatinine ELISA Kit
EF017649	Lifescience Market	96 Tests	EUR 689

Cr ELISA Kit| Bovine Creatinine ELISA Kit
EF011042	Lifescience Market	96 Tests	EUR 689

Mouse Creatinine (Cr) CLIA Kit
abx196864-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Creatinine (Cr) CLIA Kit
abx196865-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Canine CR ELISA Kit
ECC0392	Abclonal	96Tests	EUR 521

Canine Cr ELISA Kit
ECC0828	Abclonal	96Tests	EUR 521

Human Calretinin (CR) ELISA Kit
DLR-CR-Hu-48T	DL Develop	48T	EUR 479
Should the Human Calretinin (CR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Calretinin (CR) ELISA Kit
DLR-CR-Hu-96T	DL Develop	96T	EUR 621
Should the Human Calretinin (CR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Calretinin (CR) ELISA Kit
RDR-CR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Calretinin (CR) ELISA Kit
RDR-CR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Calretinin (CR) ELISA Kit
RD-CR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Calretinin (CR) ELISA Kit
RD-CR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Creatinine ELISA Kit| Mouse Creatinine ELISA Kit
EF013537	Lifescience Market	96 Tests	EUR 689

Creatinine ELISA Kit
DLR-Crtn-Ge-48T	DL Develop	48T	EUR 469
Should the Creatinine ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Creatinine in samples from serum, plasma, tissue homogenates or other biological fluids.

Creatinine ELISA Kit
DLR-Crtn-Ge-96T	DL Develop	96T	EUR 608
Should the Creatinine ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Creatinine in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Urinary Creatinine(Urinary Creatinine) ELISA Kit
QY-E05390	Qayee Biotechnology	96T	EUR 361

Goat Creatinine ELISA kit
E06C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Creatinine ELISA kit
E06C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Creatinine ELISA kit
E06C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit
E02C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit
E02C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit
E02C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit
E03C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit
E03C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit
E03C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit
E04C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit
E04C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit
E04C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatinine ELISA kit
E01C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatinine ELISA kit
E01C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatinine ELISA kit
E01C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit
E07C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit
E07C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit
E07C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit
E08C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit
E08C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit
E08C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit
E09C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit
E09C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit
E09C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Creatinine (Human) ELISA Kit
E4368-100	Biovision		EUR 756

Creatinine (Mouse) ELISA Kit
E4369-100	Biovision		EUR 805

Creatinine (Rat) ELISA Kit
E4370-100	Biovision		EUR 805

Mouse Creatinine ELISA Kit
DEIABL-M4	Creative Diagnostics	96T	EUR 627
Description: This CD Creatinine ELISA kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Mouse Creatinine. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

General Creatinine ELISA Kit
RDR-Crtn-Ge-48Tests	Reddot Biotech	48 Tests	EUR 488

General Creatinine ELISA Kit
RDR-Crtn-Ge-96Tests	Reddot Biotech	96 Tests	EUR 676

General Creatinine ELISA Kit
RD-Crtn-Ge-48Tests	Reddot Biotech	48 Tests	EUR 467

General Creatinine ELISA Kit
RD-Crtn-Ge-96Tests	Reddot Biotech	96 Tests	EUR 646

Human CR ELISA Kit
EHC0392	Abclonal	96Tests	EUR 521

Human Cr ELISA Kit
EHC0828	Abclonal	96Tests	EUR 521

Goat CR ELISA Kit
EGTC0392	Abclonal	96Tests	EUR 521

Goat Cr ELISA Kit
EGTC0828	Abclonal	96Tests	EUR 521

Chicken CR ELISA Kit
ECKC0392	Abclonal	96Tests	EUR 521

Bovine CR ELISA Kit
EBC0392	Abclonal	96Tests	EUR 521

Bovine Cr ELISA Kit
EBC0828	Abclonal	96Tests	EUR 521

Anserini CR ELISA Kit
EAC0392	Abclonal	96Tests	EUR 521

Anserine Cr ELISA Kit
EAC0828	Abclonal	96Tests	EUR 521

Cr ELISA KIT|Human
EF007458	Lifescience Market	96 Tests	EUR 689

Porcine CR ELISA Kit
EPC0392	Abclonal	96Tests	EUR 521

Porcine Cr ELISA Kit
EPC0828	Abclonal	96Tests	EUR 521

Rat CR ELISA Kit
ERC0392	Abclonal	96Tests	EUR 521

Rat Cr ELISA Kit
ERC0828	Abclonal	96Tests	EUR 521

Rabbit CR ELISA Kit
ERTC0392	Abclonal	96Tests	EUR 521

Rabbit Cr ELISA Kit
ERTC0828	Abclonal	96Tests	EUR 521

Sheep CR ELISA Kit
ESC0392	Abclonal	96Tests	EUR 521

Mouse CR ELISA Kit
EMC0392	Abclonal	96Tests	EUR 521

Mouse Cr ELISA Kit
EMC0828	Abclonal	96Tests	EUR 521

Monkey CR ELISA Kit
EMKC0392	Abclonal	96Tests	EUR 521

Creatinine
CB0328	BBI Biotech	5g	EUR 56.96
Product category: Biochemicals/Misc. Biochemicals

Creatinine
B1717-50	ApexBio	50 mg	EUR 128
Description: Creatinine is a break-down product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body.

Creatinine
HY-B0504	MedChemExpress	500mg	EUR 108

Creatinine
GK8780-100G	Glentham Life Sciences	100 g	EUR 126

Creatinine
GK8780-25G	Glentham Life Sciences	25 g	EUR 62

Creatinine Assay Kit
abx098422-Hitachi7020R150ml3R250ml1	Abbexa	Hitachi 7020; R1: 50ml×3 R2: 50ml×1	EUR 519
Shipped within 5-12 working days.

Creatinine Assay Kit
abx098422-Hitachi7060R190ml2R260ml1	Abbexa	Hitachi 7060; R1: 90ml×2 R2: 60ml×1	EUR 472
Shipped within 5-12 working days.

Creatinine Assay Kit
abx098422-Toshiba120R140ml3R240ml1	Abbexa	Toshiba 120; R1: 40ml×3 R2: 40ml×1	EUR 566
Shipped within 5-12 working days.

Creatinine Assay Kit
abx098422-Toshiba120R150ml3R250ml1	Abbexa	Toshiba 120; R1: 50ml×3 R2: 50ml×1	EUR 519
Shipped within 5-12 working days.

Creatinine Assay Kit
abx098422-Toshiba40R150ml3R250ml1	Abbexa	Toshiba 40; R1: 50ml×3 R2: 50ml×1	EUR 519
Shipped within 5-12 working days.

Creatinine Assay Kit
55R-1467	Fitzgerald	100 assays	EUR 638
Description: Assay Kit for detection of Creatinine in the research laboratory

Creatinine Assay Kit
Z5030020	Biochain	500 assays	EUR 647
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Guinea pig Creatinine ELISA kit
E05C0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Creatinine ELISA kit
E05C0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Creatinine ELISA kit
E05C0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for General Creatinine
EK4382	SAB	96 tests	EUR 502
Description: Enzyme-linked immunosorbent assay kit for quantification of General Creatinine in samples from serum, plasma, tissue homogenates and other biological fluids.

Goat Crosslaps,Cr ELISA kit
E06C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Crosslaps,Cr ELISA kit
E06C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Crosslaps,Cr ELISA kit
E06C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crosslaps,Cr ELISA kit
E02C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crosslaps,Cr ELISA kit
E02C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crosslaps,Cr ELISA kit
E02C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit
E03C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit
E03C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit
E03C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit
E04C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit
E04C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit
E04C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit
E01C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit
E01C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit
E01C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Calretinin, CR ELISA Kit
ELA-E0687m	Lifescience Market	96 Tests	EUR 865

Rat Calretinin, CR ELISA Kit
ELA-E0687r	Lifescience Market	96 Tests	EUR 886

Human Crosslaps, Cr ELISA Kit
ELA-E0892h	Lifescience Market	96 Tests	EUR 824

Guinea Pig CR ELISA Kit
EGC0392	Abclonal	96Tests	EUR 521

Guinea Pig Cr ELISA Kit
EGC0828	Abclonal	96Tests	EUR 521

Dog Crosslaps,Cr ELISA kit
E08C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Crosslaps,Cr ELISA kit
E08C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Crosslaps,Cr ELISA kit
E08C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit
E09C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit
E09C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit
E09C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit
E07C2033-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit
E07C2033-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit
E07C2033-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calretinin(CR)ELISA Kit
GA-E1496HM-48T	GenAsia Biotech	48T	EUR 289

Human Calretinin(CR)ELISA Kit
GA-E1496HM-96T	GenAsia Biotech	96T	EUR 466

Human Crosslaps(Cr)ELISA Kit
GA-E1539HM-48T	GenAsia Biotech	48T	EUR 289

Human Crosslaps(Cr)ELISA Kit
GA-E1539HM-96T	GenAsia Biotech	96T	EUR 466

Rat Calretinin(CR)ELISA Kit
GA-E0249RT-48T	GenAsia Biotech	48T	EUR 317

Rat Calretinin(CR)ELISA Kit
GA-E0249RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Calretinin(CR)ELISA Kit
GA-E0254MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Calretinin(CR)ELISA Kit
GA-E0254MS-96T	GenAsia Biotech	96T	EUR 534

Rat Crosslaps(Cr)ELISA Kit
GA-E0280RT-48T	GenAsia Biotech	48T	EUR 317

Rat Crosslaps(Cr)ELISA Kit
GA-E0280RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Crosslaps(Cr)ELISA Kit
GA-E0395MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Crosslaps(Cr)ELISA Kit
GA-E0395MS-96T	GenAsia Biotech	96T	EUR 534

Rabbit Crosslaps,Cr ELISA Kit
GA-E0063RB-48T	GenAsia Biotech	48T	EUR 326

Rabbit Crosslaps,Cr ELISA Kit
GA-E0063RB-96T	GenAsia Biotech	96T	EUR 524

Rat CR(Calretinin) ELISA Kit
ER0863	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Alias: CR(Calretinin)/CALB2/CAB29/CAL2/29 kDa calbindin/calbindin 2/calbindin 2,(29kD, calretinin)/calbindin D29K
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.469 ng/ml

Human Calretinin,CR ELISA Kit
201-12-1480	SunredBio	96 tests	EUR 440
This Calretinin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Crosslaps,Cr ELISA Kit
201-12-1523	SunredBio	96 tests	EUR 440
This Crosslaps ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Calretinin,CR ELISA Kit
CN-01684R1	ChemNorm	96T	EUR 441

Rat Calretinin,CR ELISA Kit
CN-01684R2	ChemNorm	48T	EUR 291

Rat Crosslaps,Cr ELISA Kit
CN-01838R1	ChemNorm	96T	EUR 455

Rat Crosslaps,Cr ELISA Kit
CN-01838R2	ChemNorm	48T	EUR 304

Mouse Calretinin,CR ELISA Kit
CN-02554M1	ChemNorm	96T	EUR 494

Mouse Calretinin,CR ELISA Kit
CN-02554M2	ChemNorm	48T	EUR 344

Mouse Crosslaps,Cr ELISA Kit
CN-02715M1	ChemNorm	96T	EUR 449

Mouse Crosslaps,Cr ELISA Kit
CN-02715M2	ChemNorm	48T	EUR 299

Human Calretinin,CR ELISA Kit
CN-03978H1	ChemNorm	96T	EUR 458

Human Calretinin,CR ELISA Kit
CN-03978H2	ChemNorm	48T	EUR 307

Human Crosslaps,Cr ELISA Kit
CN-03988H1	ChemNorm	96T	EUR 434

Human Crosslaps,Cr ELISA Kit
CN-03988H2	ChemNorm	48T	EUR 284

Rabbit Crosslaps,Cr ELISA Kit
CN-00655R1	ChemNorm	96T	EUR 442

Rabbit Crosslaps,Cr ELISA Kit
CN-00655R2	ChemNorm	48T	EUR 293

Human Calretinin (CR) ELISA Kit
SEA687Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit
SEA687Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit
SEA687Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit
SEA687Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit
4-SEA687Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Calretinin elisa. Alternative names of the recognized antigen: CALB2 CAL2 CAB29 Calbindin 2, 29kDa
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Calretinin ELISA Kit (CR)
RK01179	Abclonal	96 Tests	EUR 521

Human Crosslaps(Cr)ELISA Kit
QY-E03304	Qayee Biotechnology	96T	EUR 361

Human Calretinin(CR)ELISA Kit
QY-E03495	Qayee Biotechnology	96T	EUR 361

Rat Crosslaps(Cr)ELISA Kit
QY-E11372	Qayee Biotechnology	96T	EUR 361

Rat Calretinin(CR)ELISA Kit
QY-E11403	Qayee Biotechnology	96T	EUR 361

Rabbit Crosslaps,Cr ELISA Kit
QY-E30237	Qayee Biotechnology	96T	EUR 374