etrandrine mediates renal function and redox homeostasis

Protecting Results of Crocetin in opposition to Radiation-Induced Damage in Intestinal Epithelial Cells


Background and goals: Therapy choices for radiation-induced intestinal damage (RIII) are restricted. Crocetin has been demonstrated to exert antioxidant, antiapoptotic, and anti inflammatory results on varied ailments. Right here, we examine the results of crocetin on RIII in vitroSupplies and Methodology. IEC-6 cells uncovered to 10 Gy of radiation have been handled with totally different doses of crocetin (0, 0.1, 1, 10, and 100 μM), and cell viability was assessed by CCK-8.


The degrees of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), malondialdehyde (MDA), myeloperoxidase (MPO), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interferon-γ (IFN-γ) in tradition supernatants have been measured utilizing colorimetric and ELISA kits, respectively. Mobile apoptosis was evaluated by Annexin V/PI double staining.


Outcomes: Crocetin dose-dependently improved the survival of irradiated IEC-6 cells with the optimum dose of 10 μM, as indicated by the discount of mobile apoptosis, decreased ranges of MDA, MPO, and proinflammatory cytokines (TNF-α, IL-1β, and IFN-γ), and elevated actions of antioxidative enzymes (SOD, CAT, and GPx).


Human Mucin 7, Secreted (MUC7) ELISA Kit

DLR-MUC7-Hu-96T 96T
EUR 647
  • Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

RD-MUC7-Hu-48Tests 48 Tests
EUR 500

Human Mucin 7, Secreted (MUC7) ELISA Kit

RD-MUC7-Hu-96Tests 96 Tests
EUR 692

Human Mucin 7, Secreted (MUC7) ELISA Kit

RDR-MUC7-Hu-48Tests 48 Tests
EUR 522

Human Mucin 7, Secreted (MUC7) ELISA Kit

RDR-MUC7-Hu-96Tests 96 Tests
EUR 724

Human MUC7/ Mucin-7 ELISA Kit

E1675Hu 1 Kit
EUR 571

Human MUC7(Mucin-7) ELISA Kit

EH1942 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q8TAX7
  • Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- 7, MUC7 ELISA KIT

ELI-05843h 96 Tests
EUR 824

Human Mucin-7(MUC7)ELISA Kit

GA-E1630HM-48T 48T
EUR 289

Human Mucin-7(MUC7)ELISA Kit

GA-E1630HM-96T 96T
EUR 466

Human Mucin-7,MUC7 ELISA Kit

201-12-1614 96 tests
EUR 440
  • This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin-7, MUC7 ELISA Kit

CSB-E11853h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-7, MUC7 ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-7(MUC7)ELISA Kit

QY-E00294 96T
EUR 361

Mucin 7 (MUC7) Antibody

abx216981-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit

abx572156-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human MUC7 (Mucin 7)

E-EL-H2281 1 plate of 96 wells
EUR 534
  • Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

Human Mucin-7, Secreted (MUC7) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit

abx251263-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-48T 48T
EUR 354
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-5platesof96wells 5 plates of 96 wells
EUR 2252
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-96T 96T
EUR 572
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mucin 7, Secreted elisa. Alternative names of the recognized antigen: MG2
  • Mucin 7, Salivary
  • Apo-MG2
  • Salivary mucin-7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Mucin 7, Secreted ELISA Kit (MUC7)

RK01900 96 Tests
EUR 521

Human Mucin 7 (MUC7) CLIA Kit

abx197312-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Mucin-7, Secreted (MUC7) ELISA Kit

abx361133-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Mucin-7, Secreted (MUC7) ELISA Kit

abx363009-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse MUC7 (Mucin-7)

E-EL-M0801 1 plate of 96 wells
EUR 534
  • Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse MUC7 (Mucin-7) in samples from Serum, Plasma, Cell supernatant

Mouse Mucin-7, Secreted (MUC7) ELISA Kit

abx350994-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Mucin-7, Secreted (MUC7) ELISA Kit

abx355984-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Mucin-7, Secreted (MUC7) ELISA Kit

abx359170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-48T 48T
EUR 332
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-96T 96T
EUR 539
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Mucin-7(MUC7)ELISA Ki      

GA-E0485MS-48T 48T
EUR 336

Mouse Mucin-7(MUC7)ELISA Ki      

GA-E0485MS-96T 96T
EUR 534

ELISA kit for Human MUC7 (Mucin 7, Secreted)

ELK2203 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 7, Secreted (MUC7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 7,
  • Show more
Description: A sandwich ELISA kit for detection of Mucin 7, Secreted from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Mucin 7, Secreted (MUC7)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.8kDa
  • Isoelectric Point: 8.2
Description: Recombinant Human Recombinant Mucin 7, Secreted (MUC7) expressed in: E.coli

Human Mucin-7, Secreted (MUC7) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

CLIA kit for Human MUC7 (Mucin 7)

E-CL-H1342 1 plate of 96 wells
EUR 584
  • Gentaur's MUC7 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

Human Mucin 7, Secreted (MUC7) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Mucin-7, Secreted (MUC7) ELISA Kit

abx357346-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Mucin 7 ELISA kit

E01M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit

E01M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit

E01M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MUC7 ELISA Kit

EHM0361 96Tests
EUR 521

Human MUC7 ELISA Kit

ELA-E1808h 96 Tests
EUR 824


EF006051 96 Tests
EUR 689

ELISA kit for Human Mucin-7

EK3979 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Mucin 7 ELISA kit

E02M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit

E02M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit

E02M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MUC7 ELISA Kit (Human) (OKEH01290)

OKEH01290 96 Wells
EUR 662
Description: Description of target: This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Guinea pig Mucin 7 ELISA kit

E05M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit

E05M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit

E05M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EGTM0361 96Tests
EUR 521

Bovine MUC7 ELISA Kit

EBM0361 96Tests
EUR 521

Chicken MUC7 ELISA Kit

ECKM0361 96Tests
EUR 521

Canine MUC7 ELISA Kit

ECM0361 96Tests
EUR 521

Anserini MUC7 ELISA Kit

EAM0361 96Tests
EUR 521

Porcine MUC7 ELISA Kit

EPM0361 96Tests
EUR 521


ERM0361 96Tests
EUR 521

Rabbit MUC7 ELISA Kit

ERTM0361 96Tests
EUR 521

Sheep MUC7 ELISA Kit

ESM0361 96Tests
EUR 521

Monkey MUC7 ELISA Kit

EMKM0361 96Tests
EUR 521

Mouse MUC7 ELISA Kit

EMM0361 96Tests
EUR 521

Guinea Pig MUC7 ELISA Kit

EGM0361 96Tests
EUR 521

MUC7 Antibody

ABD9642 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUC7 Antibody

43220-100ul 100ul
EUR 252

MUC7 Antibody

DF9642 200ul
EUR 304
Description: MUC7 Antibody detects endogenous levels of total MUC7.

MUC7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100


YF-PA24185 50 ul
EUR 334
Description: Mouse polyclonal to MUC7

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Hu-48T 48T
EUR 501
  • Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Hu-96T 96T
EUR 651
  • Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Hu-48Tests 48 Tests
EUR 503

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Hu-96Tests 96 Tests
EUR 697

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Hu-48Tests 48 Tests
EUR 525

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Hu-96Tests 96 Tests
EUR 729

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human MUC7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MUC7 Recombinant Protein (Human)

RP020392 100 ug Ask for price

MUC7 Conjugated Antibody

C43220 100ul
EUR 397

MUC7 Polyclonal Antibody

ES9828-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC7 Polyclonal Antibody

ES9828-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC7 Polyclonal Antibody

ABP59345-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody

ABP59345-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody

ABP59345-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

Anti-MUC7 Antibody

A05210 100ug/vial
EUR 294

MUC7 Blocking Peptide

DF9642-BP 1mg
EUR 195

MUC7 cloning plasmid

CSB-CL851529HU-10ug 10ug
EUR 427
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca
  • Show more
Description: A cloning plasmid for the MUC7 gene.

Anti-MUC7 antibody

STJ190986 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MUC7

Anti-MUC7 (1C10)

YF-MA14331 100 ug
EUR 363
Description: Mouse monoclonal to MUC7

Anti-MUC7 (7F2)

YF-MA10594 100 ug
EUR 363
Description: Mouse monoclonal to MUC7

Recombinant Human Galectin-7

7-00442 2µg Ask for price

Recombinant Human Galectin-7

7-00443 10µg Ask for price

Recombinant Human Galectin-7

7-00444 1mg Ask for price

Recombinant Human Interleukin-7

7-00895 2µg Ask for price

Recombinant Human Interleukin-7

7-00896 10µg Ask for price

Recombinant Human Interleukin-7

7-00897 1mg Ask for price

Recombinant Human Kallikrein-7

7-03034 2µg Ask for price

Recombinant Human Kallikrein-7

7-03035 10µg Ask for price

Recombinant Human Kallikrein-7

7-03036 100µg Ask for price

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-c-48T 48T
EUR 560
  • Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-c-96T 96T
EUR 732
  • Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Mu-48T 48T
EUR 512
  • Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Mu-96T 96T
EUR 667
  • Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Ra-48T 48T
EUR 536
  • Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Ra-96T 96T
EUR 700
  • Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-c-48Tests 48 Tests
EUR 569

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-c-96Tests 96 Tests
EUR 792

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Mu-48Tests 48 Tests
EUR 516

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Mu-96Tests 96 Tests
EUR 716

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Ra-48Tests 48 Tests
EUR 543

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Ra-96Tests 96 Tests
EUR 754

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-c-48Tests 48 Tests
EUR 595

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-c-96Tests 96 Tests
EUR 829

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Mu-48Tests 48 Tests
EUR 539

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Mu-96Tests 96 Tests
EUR 749

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Ra-48Tests 48 Tests
EUR 567

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Ra-96Tests 96 Tests
EUR 789

MUC7 ORF Vector (Human) (pORF)

ORF006798 1.0 ug DNA
EUR 95

Human Mucin (MUC) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin 2 ELISA kit

E01M0352-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit

E01M0352-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit

E01M0352-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit

E01M0353-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit

E01M0353-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit

E01M0353-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit

E01M0358-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit

E01M0358-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit

E01M0358-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 17 ELISA Kit

ELA-E0403h 96 Tests
EUR 824

Human Gastric Mucin ELISA Kit

ELA-E1335h 96 Tests
EUR 824

Human Mucin (MUC) ELISA Kit

SES095Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit

SES095Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Prevalence of SARS-CoV-2 an infection in India: Findings from the nationwide serosurvey, Might-June 2020


Background & goals: Inhabitants-based seroepidemiological research measure the extent of SARS-CoV-2 an infection in a rustic. We report the findings of the primary spherical of a nationwide serosurvey, carried out to estimate the seroprevalence of SARS-CoV-2 an infection amongst grownup inhabitants of India.


Strategies: From Might 11 to June 4, 2020, a randomly sampled, community-based survey was carried out in 700 villages/wards, chosen from the 70 districts of the 21 States of India, categorized into 4 strata based mostly on the incidence of reported COVID-19 circumstances. 4 hundred adults per district have been enrolled from 10 clusters with one grownup per family. Serum samples have been examined for IgG antibodies utilizing COVID Kavach ELISA package.


All constructive serum samples have been re-tested utilizing Euroimmun SARS-CoV-2 ELISA. Adjusting for survey design and serial check efficiency, weighted seroprevalence, variety of infections, an infection to case ratio (ICR) and an infection fatality ratio (IFR) have been calculated. Logistic regression was used to find out the elements related to IgG positivity.


Outcomes: Whole of 30,283 households have been visited and 28,000 people have been enrolled. Inhabitants-weighted seroprevalence after adjusting for check efficiency was 0.73 per cent [95% confidence interval (CI): 0.34-1.13]. Males, dwelling in city slums and occupation with excessive threat of publicity to doubtlessly contaminated individuals have been related to seropositivity.


A cumulative 6,468,388 grownup infections (95% CI: 3,829,029-11,199,423) have been estimated in India by the early Might. The general ICR was between 81.6 (95% CI: 48.3-141.4) and 130.1 (95% CI: 77.0-225.2) with Might 11 and Might 3, 2020 as believable reference factors for reported circumstances. The IFR within the surveyed districts from excessive stratum, the place dying reporting was extra strong, was 11.72 (95% CI: 7.21-19.19) to 15.04 (9.26-24.62) per 10,000 adults, utilizing Might 24 and June 1, 2020 as believable reference factors for reported deaths.


Interpretation & conclusions: Seroprevalence of SARS-CoV-2 was low among the many grownup inhabitants in India across the starting of Might 2020. Additional nationwide and native serosurveys are really useful to raised inform the general public well being technique for containment and mitigation of the epidemic in varied elements of the nation.

Tetrandrine mediates renal operate and redox homeostasis in a streptozotocin-induced diabetic nephropathy rat mannequin by Nrf2/HO-1 reactivation


Background: Diabetic nephropathy (DN) is the main reason for morbidity and mortality in diabetic sufferers. Tetrandrine (Tet), a bisbenzylisoquinoline alkaloid remoted from the roots of Stephania tetrandra, possesses anti-oxidative, anti-hypertensive, anti-inflammatory capacities. On this examine, the upkeep function of Tet in DN was evaluated in streptozotocin (STZ)-induced diabetic rats.


Strategies: In vitro examine, rats have been divided into 5 teams (n=10): the management group, the DN mannequin group, the Tet-treatment group (5, 15, 30 mg/kg). DN harm was assessed by ranges of blood glucose, serum creatinine (CRE), proteinuria, and urea nitrogen. ELISA assay was used to detecte tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6) and IL-10 ranges.


Kits have been used to detecte contents of malondialdehyde (MDA), lactate dehydrogenase (LDH) and superoxide dismutase (SOD). Dichlorofluorescein (DCF) staining was used to detecte reactive oxygen species (ROS). HE staining assessed pathological harm. TUNEL staining assessed tissue apoptosis. Western Blot (WB) was used to detecte ranges of Ki67, Survivin, Bax, Bcl-2, caspase-3, -9, c-Myc, nuclear issue erythroid-derived 2-related issue 2 (Nrf2), p-Nrf2, and heme oxygenase-1 (HO-1).


Outcomes: In contrast with the management group, STZ-induced considerably inhibited proliferation proteins’ stage, activated oxidative stress, aggravated tissue irritation and promoted tissue apoptosis. STZ-induced additional aggravated DN harm. Of word, these anomalies have been restored by Tet pretreatment. Moreover, Tet upgraded the expression of p-Nrf2 and HO-1.


Conclusions: These outcomes indicated that Tet might considerably restrain diabetic course of and renal harm. Tet is a possible therapeutic agent in DN remedy through the reactivation of the Nrf2/HO-1.




Creatinine (Cr) ELISA Kit

abx350661-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Creatinine,Cr ELISA Kit

201-12-1090 96 tests
EUR 440
  • This Creatinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Cr (Creatinine)

E-EL-0058 1 plate of 96 wells
EUR 377
  • Gentaur's Cr ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Cr. During the reaction, Cr in the sample or standard competes with a fixed amount of Cr on the solid phase supporter
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Cr (Creatinine) in samples from Serum, Plasma, Cell supernatant

General Cr/ Creatinine ELISA Kit

E0017Ge 1 Kit
EUR 563

Human Cr(Creatinine) ELISA Kit

EH4306 96T
EUR 476.25
  • Detection range: 1.25-80nmol/ml
  • Alias: Creatinine
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75nmol/ml

Bovine Cr(Creatinine) ELISA Kit

EB0090 96T
EUR 567.6
  • Detection range: 1.25-80nmol/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Cattle;Sensitivity: 0.75nmol/ml

General Creatinine, Cr ELISA KIT

ELI-07047Ge 96 Tests
EUR 886

Mouse Cr(Creatinine) ELISA Kit

EM0950 96T
EUR 524.1
  • Detection range: 1.25-80nmol/ml
  • Alias: Cr
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 0.75nmol/ml

Rat Cr(Creatinine) ELISA Kit

ER0864 96T
EUR 524.1
  • Detection range: 1.25-80nmol/ml
  • Alias: Cr
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.75nmol/ml

Human Creatinine(Cr)ELISA Kit

GA-E1106HM-48T 48T
EUR 289

Human Creatinine(Cr)ELISA Kit

GA-E1106HM-96T 96T
EUR 466

Rat Creatinine(Cr)ELISA Kit

GA-E0315RT-48T 48T
EUR 317

Rat Creatinine(Cr)ELISA Kit

GA-E0315RT-96T 96T
EUR 496

Human Creatinine(Cr)ELISA Kit

QY-E03067 96T
EUR 361

Rat Creatinine(Cr)ELISA Kit

QY-E11337 96T
EUR 361

Mouse Creatinine(Cr)ELISA Kit

QY-E20401 96T
EUR 361

Creatinine (Cr) CLIA Kit

abx197924-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human Creatinine (Cr)

KTE62273-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Creatinine (Cr)

KTE62273-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Creatinine (Cr)

KTE62273-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Creatinine (Cr) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cr ELISA Kit| Rat Creatinine ELISA Kit

EF017649 96 Tests
EUR 689

Cr ELISA Kit| Bovine Creatinine ELISA Kit

EF011042 96 Tests
EUR 689

Mouse Creatinine (Cr) CLIA Kit

abx196864-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Creatinine (Cr) CLIA Kit

abx196865-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Canine CR ELISA Kit

ECC0392 96Tests
EUR 521

Canine Cr ELISA Kit

ECC0828 96Tests
EUR 521

Human Calretinin (CR) ELISA Kit

DLR-CR-Hu-48T 48T
EUR 479
  • Should the Human Calretinin (CR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Calretinin (CR) ELISA Kit

DLR-CR-Hu-96T 96T
EUR 621
  • Should the Human Calretinin (CR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Calretinin (CR) ELISA Kit

RDR-CR-Hu-48Tests 48 Tests
EUR 500

Human Calretinin (CR) ELISA Kit

RDR-CR-Hu-96Tests 96 Tests
EUR 692

Human Calretinin (CR) ELISA Kit

RD-CR-Hu-48Tests 48 Tests
EUR 478

Human Calretinin (CR) ELISA Kit

RD-CR-Hu-96Tests 96 Tests
EUR 662

Creatinine ELISA Kit| Mouse Creatinine ELISA Kit

EF013537 96 Tests
EUR 689

Creatinine ELISA Kit

DLR-Crtn-Ge-48T 48T
EUR 469
  • Should the Creatinine ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Creatinine in samples from serum, plasma, tissue homogenates or other biological fluids.

Creatinine ELISA Kit

DLR-Crtn-Ge-96T 96T
EUR 608
  • Should the Creatinine ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Creatinine in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Urinary Creatinine(Urinary Creatinine) ELISA Kit

QY-E05390 96T
EUR 361

Mouse Creatinine ELISA Kit

EUR 627
Description: This CD Creatinine ELISA kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Mouse Creatinine. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

Human Creatinine ELISA kit

E01C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatinine ELISA kit

E01C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatinine ELISA kit

E01C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Creatinine ELISA kit

E06C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Creatinine ELISA kit

E06C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Creatinine ELISA kit

E06C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit

E03C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit

E03C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Creatinine ELISA kit

E03C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit

E04C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit

E04C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Creatinine ELISA kit

E04C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit

E02C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit

E02C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Creatinine ELISA kit

E02C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit

E09C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit

E09C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Creatinine ELISA kit

E09C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit

E08C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit

E08C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Creatinine ELISA kit

E08C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit

E07C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit

E07C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Creatinine ELISA kit

E07C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Creatinine (Human) ELISA Kit

EUR 756

Creatinine (Mouse) ELISA Kit

EUR 805

Creatinine (Rat) ELISA Kit

EUR 805

General Creatinine ELISA Kit

RDR-Crtn-Ge-48Tests 48 Tests
EUR 488

General Creatinine ELISA Kit

RDR-Crtn-Ge-96Tests 96 Tests
EUR 676

General Creatinine ELISA Kit

RD-Crtn-Ge-48Tests 48 Tests
EUR 467

General Creatinine ELISA Kit

RD-Crtn-Ge-96Tests 96 Tests
EUR 646

Creatinine ELISA Kit (OKEH02617)

OKEH02617 96 Wells
EUR 688
Description: Description of target: Measuring serum creatinine is a simple test and it is the most commonly used indicator of renal function. In the United States, creatinine is typically reported in mg/dL, whereas, in Canada and a few European countries, umol/litre may be used. 1 mg/dL of creatinine is 88.4 umol/L. The typical human reference ranges for serum creatinine are 0.5 to 1.0 mg/dL (about 45-90 umol/L) for women and 0.7 to 1.2 mg/dL (60-110 umol/L) for men. While a baseline (medicine) serum creatinine of 2.0 mg/dL (150 umol/L) may indicate normal kidney function in a male body builder, a serum creatinine of 1.2 mg/dL (110 umol/L) can indicate significant renal disease in an elderly female. for male reference range are 60-120 umol/L and for female it is 50-110 umol/L. Creatinine is a break-down product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body (depending on muscle mass).;Species reactivity: All;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 1.4umol/ml

Human CR ELISA Kit

EHC0392 96Tests
EUR 521

Human Cr ELISA Kit

EHC0828 96Tests
EUR 521


EGTC0392 96Tests
EUR 521

Goat Cr ELISA Kit

EGTC0828 96Tests
EUR 521

Bovine CR ELISA Kit

EBC0392 96Tests
EUR 521

Bovine Cr ELISA Kit

EBC0828 96Tests
EUR 521

Chicken CR ELISA Kit

ECKC0392 96Tests
EUR 521

Anserini CR ELISA Kit

EAC0392 96Tests
EUR 521

Anserine Cr ELISA Kit

EAC0828 96Tests
EUR 521


EF007458 96 Tests
EUR 689

Mouse CR ELISA Kit

EMC0392 96Tests
EUR 521

Mouse Cr ELISA Kit

EMC0828 96Tests
EUR 521


ERC0392 96Tests
EUR 521

Rat Cr ELISA Kit

ERC0828 96Tests
EUR 521

Sheep CR ELISA Kit

ESC0392 96Tests
EUR 521

Rabbit CR ELISA Kit

ERTC0392 96Tests
EUR 521

Rabbit Cr ELISA Kit

ERTC0828 96Tests
EUR 521

Monkey CR ELISA Kit

EMKC0392 96Tests
EUR 521

Porcine CR ELISA Kit

EPC0392 96Tests
EUR 521

Porcine Cr ELISA Kit

EPC0828 96Tests
EUR 521


B1717-50 50 mg
EUR 128
Description: Creatinine is a break-down product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body.


HY-B0504 500mg
EUR 108


GK8780-100G 100 g
EUR 126


GK8780-25G 25 g
EUR 62


CB0328 5g
EUR 56.96
  • Product category: Biochemicals/Misc. Biochemicals

Creatinine Assay Kit

55R-1467 100 assays
EUR 638
Description: Assay Kit for detection of Creatinine in the research laboratory

Creatinine Assay Kit

abx098422-Hitachi7020R150ml3R250ml1 Hitachi 7020; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Hitachi7060R190ml2R260ml1 Hitachi 7060; R1: 90ml×2 R2: 60ml×1
EUR 472
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R140ml3R240ml1 Toshiba 120; R1: 40ml×3 R2: 40ml×1
EUR 566
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R150ml3R250ml1 Toshiba 120; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba40R150ml3R250ml1 Toshiba 40; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

Z5030020 500 assays
EUR 647
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Guinea pig Creatinine ELISA kit

E05C0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Creatinine ELISA kit

E05C0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Creatinine ELISA kit

E05C0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Creatinine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for General Creatinine

EK4382 96 tests
EUR 502
Description: Enzyme-linked immunosorbent assay kit for quantification of General Creatinine in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin,CR ELISA Kit

201-12-1480 96 tests
EUR 440
  • This Calretinin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Crosslaps,Cr ELISA Kit

201-12-1523 96 tests
EUR 440
  • This Crosslaps ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Crosslaps,Cr ELISA kit

E02C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crosslaps,Cr ELISA kit

E02C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crosslaps,Cr ELISA kit

E02C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit

E03C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit

E03C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crosslaps,Cr ELISA kit

E03C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Crosslaps,Cr ELISA kit

E06C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Crosslaps,Cr ELISA kit

E06C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Crosslaps,Cr ELISA kit

E06C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit

E04C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit

E04C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Crosslaps,Cr ELISA kit

E04C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit

E01C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit

E01C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crosslaps,Cr ELISA kit

E01C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit

E09C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit

E09C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Crosslaps,Cr ELISA kit

E09C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Calretinin, CR ELISA Kit

ELA-E0687m 96 Tests
EUR 865

Rat Calretinin, CR ELISA Kit

ELA-E0687r 96 Tests
EUR 886

Human Crosslaps, Cr ELISA Kit

ELA-E0892h 96 Tests
EUR 824

Guinea Pig Cr ELISA Kit

EGC0828 96Tests
EUR 521

Dog Crosslaps,Cr ELISA kit

E08C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Crosslaps,Cr ELISA kit

E08C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Crosslaps,Cr ELISA kit

E08C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit

E07C2033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit

E07C2033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Crosslaps,Cr ELISA kit

E07C2033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Crosslaps,Cr in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig CR ELISA Kit

EGC0392 96Tests
EUR 521

Rabbit Crosslaps,Cr ELISA Kit

CN-00655R1 96T
EUR 442

Rabbit Crosslaps,Cr ELISA Kit

CN-00655R2 48T
EUR 293

Rat Calretinin,CR ELISA Kit

CN-01684R1 96T
EUR 441

Rat Calretinin,CR ELISA Kit

CN-01684R2 48T
EUR 291

Rat Crosslaps,Cr ELISA Kit

CN-01838R1 96T
EUR 455

Rat Crosslaps,Cr ELISA Kit

CN-01838R2 48T
EUR 304

Mouse Calretinin,CR ELISA Kit

CN-02554M1 96T
EUR 494

Mouse Calretinin,CR ELISA Kit

CN-02554M2 48T
EUR 344

Mouse Crosslaps,Cr ELISA Kit

CN-02715M1 96T
EUR 449

Mouse Crosslaps,Cr ELISA Kit

CN-02715M2 48T
EUR 299

Human Calretinin,CR ELISA Kit

CN-03978H1 96T
EUR 458

Human Calretinin,CR ELISA Kit

CN-03978H2 48T
EUR 307

Human Crosslaps,Cr ELISA Kit

CN-03988H1 96T
EUR 434

Human Crosslaps,Cr ELISA Kit

CN-03988H2 48T
EUR 284

Rat CR(Calretinin) ELISA Kit

ER0863 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Alias: CR(Calretinin)/CALB2/CAB29/CAL2/29 kDa calbindin/calbindin 2/calbindin 2,(29kD, calretinin)/calbindin D29K
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.469 ng/ml

Human Calretinin(CR)ELISA Kit

GA-E1496HM-48T 48T
EUR 289

Human Calretinin(CR)ELISA Kit

GA-E1496HM-96T 96T
EUR 466

Human Crosslaps(Cr)ELISA Kit

GA-E1539HM-48T 48T
EUR 289

Human Crosslaps(Cr)ELISA Kit

GA-E1539HM-96T 96T
EUR 466

Mouse Crosslaps(Cr)ELISA Kit

GA-E0395MS-48T 48T
EUR 336

Mouse Crosslaps(Cr)ELISA Kit

GA-E0395MS-96T 96T
EUR 534

Rat Calretinin(CR)ELISA Kit

GA-E0249RT-48T 48T
EUR 317

Rat Calretinin(CR)ELISA Kit

GA-E0249RT-96T 96T
EUR 496

Mouse Calretinin(CR)ELISA Kit      

GA-E0254MS-48T 48T
EUR 336

Mouse Calretinin(CR)ELISA Kit      

GA-E0254MS-96T 96T
EUR 534

Rat Crosslaps(Cr)ELISA Kit

GA-E0280RT-48T 48T
EUR 317

Rat Crosslaps(Cr)ELISA Kit

GA-E0280RT-96T 96T
EUR 496

Rabbit Crosslaps,Cr ELISA Kit

GA-E0063RB-48T 48T
EUR 326

Rabbit Crosslaps,Cr ELISA Kit

GA-E0063RB-96T 96T
EUR 524

Human Crosslaps(Cr)ELISA Kit

QY-E03304 96T
EUR 361

Human Calretinin(CR)ELISA Kit

QY-E03495 96T
EUR 361

Rat Crosslaps(Cr)ELISA Kit

QY-E11372 96T
EUR 361

Rat Calretinin(CR)ELISA Kit

QY-E11403 96T
EUR 361

Human Calretinin ELISA Kit (CR)

RK01179 96 Tests
EUR 521

Human Calretinin (CR) ELISA Kit

SEA687Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit

SEA687Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit

SEA687Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit

SEA687Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calretinin (CR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calretinin (CR) in serum, plasma, tissue homogenates and other biological fluids.

Human Calretinin (CR) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Calretinin elisa. Alternative names of the recognized antigen: CALB2
  • CAL2
  • CAB29
  • Calbindin 2, 29kDa
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Calretinin (CR) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.